ID: 1048215114

View in Genome Browser
Species Human (GRCh38)
Location 8:132486962-132486984
Sequence CGCTCTTAAACGCAGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215114_1048215116 4 Left 1048215114 8:132486962-132486984 CCATGTGCCTGCGTTTAAGAGCG No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data
1048215114_1048215123 21 Left 1048215114 8:132486962-132486984 CCATGTGCCTGCGTTTAAGAGCG No data
Right 1048215123 8:132487006-132487028 TCAAGGGGGCTGAATGCAGCAGG No data
1048215114_1048215118 5 Left 1048215114 8:132486962-132486984 CCATGTGCCTGCGTTTAAGAGCG No data
Right 1048215118 8:132486990-132487012 CCCAGAGTCCACTTGCTCAAGGG No data
1048215114_1048215121 7 Left 1048215114 8:132486962-132486984 CCATGTGCCTGCGTTTAAGAGCG No data
Right 1048215121 8:132486992-132487014 CAGAGTCCACTTGCTCAAGGGGG No data
1048215114_1048215120 6 Left 1048215114 8:132486962-132486984 CCATGTGCCTGCGTTTAAGAGCG No data
Right 1048215120 8:132486991-132487013 CCAGAGTCCACTTGCTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215114 Original CRISPR CGCTCTTAAACGCAGGCACA TGG (reversed) Intergenic
No off target data available for this crispr