ID: 1048215116

View in Genome Browser
Species Human (GRCh38)
Location 8:132486989-132487011
Sequence ACCCAGAGTCCACTTGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215115_1048215116 -3 Left 1048215115 8:132486969-132486991 CCTGCGTTTAAGAGCGTCTGACC No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data
1048215114_1048215116 4 Left 1048215114 8:132486962-132486984 CCATGTGCCTGCGTTTAAGAGCG No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data
1048215110_1048215116 24 Left 1048215110 8:132486942-132486964 CCATTTTCCCACTAATGAGCCCA No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data
1048215112_1048215116 16 Left 1048215112 8:132486950-132486972 CCACTAATGAGCCCATGTGCCTG No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data
1048215113_1048215116 5 Left 1048215113 8:132486961-132486983 CCCATGTGCCTGCGTTTAAGAGC No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data
1048215111_1048215116 17 Left 1048215111 8:132486949-132486971 CCCACTAATGAGCCCATGTGCCT No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data
1048215109_1048215116 30 Left 1048215109 8:132486936-132486958 CCATTGCCATTTTCCCACTAATG No data
Right 1048215116 8:132486989-132487011 ACCCAGAGTCCACTTGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215116 Original CRISPR ACCCAGAGTCCACTTGCTCA AGG Intergenic
No off target data available for this crispr