ID: 1048215119

View in Genome Browser
Species Human (GRCh38)
Location 8:132486991-132487013
Sequence CCCCTTGAGCAAGTGGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215119_1048215123 -8 Left 1048215119 8:132486991-132487013 CCAGAGTCCACTTGCTCAAGGGG No data
Right 1048215123 8:132487006-132487028 TCAAGGGGGCTGAATGCAGCAGG No data
1048215119_1048215124 28 Left 1048215119 8:132486991-132487013 CCAGAGTCCACTTGCTCAAGGGG No data
Right 1048215124 8:132487042-132487064 CATAGTGCCTTCAGACAAAAAGG No data
1048215119_1048215125 29 Left 1048215119 8:132486991-132487013 CCAGAGTCCACTTGCTCAAGGGG No data
Right 1048215125 8:132487043-132487065 ATAGTGCCTTCAGACAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215119 Original CRISPR CCCCTTGAGCAAGTGGACTC TGG (reversed) Intergenic
No off target data available for this crispr