ID: 1048215122

View in Genome Browser
Species Human (GRCh38)
Location 8:132486998-132487020
Sequence ATTCAGCCCCCTTGAGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215122_1048215124 21 Left 1048215122 8:132486998-132487020 CCACTTGCTCAAGGGGGCTGAAT No data
Right 1048215124 8:132487042-132487064 CATAGTGCCTTCAGACAAAAAGG No data
1048215122_1048215126 26 Left 1048215122 8:132486998-132487020 CCACTTGCTCAAGGGGGCTGAAT No data
Right 1048215126 8:132487047-132487069 TGCCTTCAGACAAAAAGGGCTGG No data
1048215122_1048215129 28 Left 1048215122 8:132486998-132487020 CCACTTGCTCAAGGGGGCTGAAT No data
Right 1048215129 8:132487049-132487071 CCTTCAGACAAAAAGGGCTGGGG No data
1048215122_1048215127 27 Left 1048215122 8:132486998-132487020 CCACTTGCTCAAGGGGGCTGAAT No data
Right 1048215127 8:132487048-132487070 GCCTTCAGACAAAAAGGGCTGGG No data
1048215122_1048215125 22 Left 1048215122 8:132486998-132487020 CCACTTGCTCAAGGGGGCTGAAT No data
Right 1048215125 8:132487043-132487065 ATAGTGCCTTCAGACAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215122 Original CRISPR ATTCAGCCCCCTTGAGCAAG TGG (reversed) Intergenic
No off target data available for this crispr