ID: 1048215123

View in Genome Browser
Species Human (GRCh38)
Location 8:132487006-132487028
Sequence TCAAGGGGGCTGAATGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215114_1048215123 21 Left 1048215114 8:132486962-132486984 CCATGTGCCTGCGTTTAAGAGCG No data
Right 1048215123 8:132487006-132487028 TCAAGGGGGCTGAATGCAGCAGG No data
1048215119_1048215123 -8 Left 1048215119 8:132486991-132487013 CCAGAGTCCACTTGCTCAAGGGG No data
Right 1048215123 8:132487006-132487028 TCAAGGGGGCTGAATGCAGCAGG No data
1048215113_1048215123 22 Left 1048215113 8:132486961-132486983 CCCATGTGCCTGCGTTTAAGAGC No data
Right 1048215123 8:132487006-132487028 TCAAGGGGGCTGAATGCAGCAGG No data
1048215115_1048215123 14 Left 1048215115 8:132486969-132486991 CCTGCGTTTAAGAGCGTCTGACC No data
Right 1048215123 8:132487006-132487028 TCAAGGGGGCTGAATGCAGCAGG No data
1048215117_1048215123 -7 Left 1048215117 8:132486990-132487012 CCCAGAGTCCACTTGCTCAAGGG No data
Right 1048215123 8:132487006-132487028 TCAAGGGGGCTGAATGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215123 Original CRISPR TCAAGGGGGCTGAATGCAGC AGG Intergenic
No off target data available for this crispr