ID: 1048215125

View in Genome Browser
Species Human (GRCh38)
Location 8:132487043-132487065
Sequence ATAGTGCCTTCAGACAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215117_1048215125 30 Left 1048215117 8:132486990-132487012 CCCAGAGTCCACTTGCTCAAGGG No data
Right 1048215125 8:132487043-132487065 ATAGTGCCTTCAGACAAAAAGGG No data
1048215122_1048215125 22 Left 1048215122 8:132486998-132487020 CCACTTGCTCAAGGGGGCTGAAT No data
Right 1048215125 8:132487043-132487065 ATAGTGCCTTCAGACAAAAAGGG No data
1048215119_1048215125 29 Left 1048215119 8:132486991-132487013 CCAGAGTCCACTTGCTCAAGGGG No data
Right 1048215125 8:132487043-132487065 ATAGTGCCTTCAGACAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215125 Original CRISPR ATAGTGCCTTCAGACAAAAA GGG Intergenic
No off target data available for this crispr