ID: 1048215820 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:132493787-132493809 |
Sequence | GTTACATGGCCATAAGTAAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048215820_1048215829 | 29 | Left | 1048215820 | 8:132493787-132493809 | CCAGTTACTTATGGCCATGTAAC | No data | ||
Right | 1048215829 | 8:132493839-132493861 | TAAAACATCCTTCTGTCTGTGGG | No data | ||||
1048215820_1048215828 | 28 | Left | 1048215820 | 8:132493787-132493809 | CCAGTTACTTATGGCCATGTAAC | No data | ||
Right | 1048215828 | 8:132493838-132493860 | GTAAAACATCCTTCTGTCTGTGG | 0: 1 1: 0 2: 0 3: 13 4: 184 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048215820 | Original CRISPR | GTTACATGGCCATAAGTAAC TGG (reversed) | Intergenic | ||