ID: 1048215820

View in Genome Browser
Species Human (GRCh38)
Location 8:132493787-132493809
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215820_1048215828 28 Left 1048215820 8:132493787-132493809 CCAGTTACTTATGGCCATGTAAC No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215820_1048215829 29 Left 1048215820 8:132493787-132493809 CCAGTTACTTATGGCCATGTAAC No data
Right 1048215829 8:132493839-132493861 TAAAACATCCTTCTGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215820 Original CRISPR GTTACATGGCCATAAGTAAC TGG (reversed) Intergenic