ID: 1048215828

View in Genome Browser
Species Human (GRCh38)
Location 8:132493838-132493860
Sequence GTAAAACATCCTTCTGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048215822_1048215828 6 Left 1048215822 8:132493809-132493831 CCAACGCCCCCCAATCTTACTCG No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215825_1048215828 -2 Left 1048215825 8:132493817-132493839 CCCCAATCTTACTCGTGCAAAGT No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215823_1048215828 0 Left 1048215823 8:132493815-132493837 CCCCCCAATCTTACTCGTGCAAA No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215821_1048215828 14 Left 1048215821 8:132493801-132493823 CCATGTAACCAACGCCCCCCAAT No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215824_1048215828 -1 Left 1048215824 8:132493816-132493838 CCCCCAATCTTACTCGTGCAAAG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215826_1048215828 -3 Left 1048215826 8:132493818-132493840 CCCAATCTTACTCGTGCAAAGTA No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215827_1048215828 -4 Left 1048215827 8:132493819-132493841 CCAATCTTACTCGTGCAAAGTAA No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data
1048215820_1048215828 28 Left 1048215820 8:132493787-132493809 CCAGTTACTTATGGCCATGTAAC No data
Right 1048215828 8:132493838-132493860 GTAAAACATCCTTCTGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048215828 Original CRISPR GTAAAACATCCTTCTGTCTG TGG Intergenic