ID: 1048216757

View in Genome Browser
Species Human (GRCh38)
Location 8:132502672-132502694
Sequence AAAGCTACTGCCTTTCTAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048216751_1048216757 20 Left 1048216751 8:132502629-132502651 CCACAGGGAGACAGGGGCCCATA No data
Right 1048216757 8:132502672-132502694 AAAGCTACTGCCTTTCTAAGCGG No data
1048216754_1048216757 3 Left 1048216754 8:132502646-132502668 CCCATAGGGTCATCCAGTTTTCT No data
Right 1048216757 8:132502672-132502694 AAAGCTACTGCCTTTCTAAGCGG No data
1048216756_1048216757 -10 Left 1048216756 8:132502659-132502681 CCAGTTTTCTCACAAAGCTACTG No data
Right 1048216757 8:132502672-132502694 AAAGCTACTGCCTTTCTAAGCGG No data
1048216755_1048216757 2 Left 1048216755 8:132502647-132502669 CCATAGGGTCATCCAGTTTTCTC No data
Right 1048216757 8:132502672-132502694 AAAGCTACTGCCTTTCTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048216757 Original CRISPR AAAGCTACTGCCTTTCTAAG CGG Intergenic
No off target data available for this crispr