ID: 1048218171

View in Genome Browser
Species Human (GRCh38)
Location 8:132515795-132515817
Sequence GAATTAATCTTGTCTGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048218171_1048218177 8 Left 1048218171 8:132515795-132515817 CCCGTTTCAGACAAGATTAATTC No data
Right 1048218177 8:132515826-132515848 TCAAGGCTTGGATGTGCAGATGG No data
1048218171_1048218178 21 Left 1048218171 8:132515795-132515817 CCCGTTTCAGACAAGATTAATTC No data
Right 1048218178 8:132515839-132515861 GTGCAGATGGAGTCTGCATTTGG No data
1048218171_1048218174 -4 Left 1048218171 8:132515795-132515817 CCCGTTTCAGACAAGATTAATTC No data
Right 1048218174 8:132515814-132515836 ATTCAACCTGCCTCAAGGCTTGG No data
1048218171_1048218173 -9 Left 1048218171 8:132515795-132515817 CCCGTTTCAGACAAGATTAATTC No data
Right 1048218173 8:132515809-132515831 GATTAATTCAACCTGCCTCAAGG No data
1048218171_1048218179 22 Left 1048218171 8:132515795-132515817 CCCGTTTCAGACAAGATTAATTC No data
Right 1048218179 8:132515840-132515862 TGCAGATGGAGTCTGCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048218171 Original CRISPR GAATTAATCTTGTCTGAAAC GGG (reversed) Intergenic
No off target data available for this crispr