ID: 1048219054

View in Genome Browser
Species Human (GRCh38)
Location 8:132524808-132524830
Sequence CTGAGCAGGAATAAAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048219054_1048219058 -3 Left 1048219054 8:132524808-132524830 CCTCCAGCTTTATTCCTGCTCAG No data
Right 1048219058 8:132524828-132524850 CAGGTTCCTATTCTACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048219054 Original CRISPR CTGAGCAGGAATAAAGCTGG AGG (reversed) Intergenic
No off target data available for this crispr