ID: 1048219448

View in Genome Browser
Species Human (GRCh38)
Location 8:132528002-132528024
Sequence CTCACGATGGGGAAGTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048219442_1048219448 23 Left 1048219442 8:132527956-132527978 CCAAGGCATTGTCTTTGGGGCAG No data
Right 1048219448 8:132528002-132528024 CTCACGATGGGGAAGTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048219448 Original CRISPR CTCACGATGGGGAAGTTAAG TGG Intergenic
No off target data available for this crispr