ID: 1048223851

View in Genome Browser
Species Human (GRCh38)
Location 8:132566422-132566444
Sequence GGCTTCCTGCTCTGCGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048223845_1048223851 4 Left 1048223845 8:132566395-132566417 CCTTGACTGTTCTTAAGGGCTTG No data
Right 1048223851 8:132566422-132566444 GGCTTCCTGCTCTGCGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048223851 Original CRISPR GGCTTCCTGCTCTGCGGGGT TGG Intergenic
No off target data available for this crispr