ID: 1048225461

View in Genome Browser
Species Human (GRCh38)
Location 8:132580993-132581015
Sequence CCAGGAGTCCACATCTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048225461_1048225465 -7 Left 1048225461 8:132580993-132581015 CCCATACAGATGTGGACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1048225465 8:132581009-132581031 CTCCTGGTCTACGACAGAGGTGG No data
1048225461_1048225464 -10 Left 1048225461 8:132580993-132581015 CCCATACAGATGTGGACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1048225464 8:132581006-132581028 GGACTCCTGGTCTACGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048225461 Original CRISPR CCAGGAGTCCACATCTGTAT GGG (reversed) Intronic
901915524 1:12496667-12496689 ACAGGAGTGCACATTTGTCTTGG - Intronic
903137718 1:21320243-21320265 CCAGCCGTCAACAGCTGTATGGG + Intronic
906036729 1:42755079-42755101 CCAGGAGTTCACATCTGCCTGGG + Intronic
911485324 1:98498040-98498062 CCCTGAGTCCACCTCCGTATGGG - Intergenic
913284088 1:117211274-117211296 CCAGGAGTCCCCATCTCTGCTGG + Intergenic
915393487 1:155564143-155564165 CCAGGAGTCCACAAATGTGAAGG - Intergenic
921214811 1:212927879-212927901 CCAGGAGCCCACGGCTCTATAGG - Intergenic
924704188 1:246485713-246485735 CCAGGAGTCCAAAGCTGTAGTGG + Intronic
924707519 1:246511703-246511725 CCAGGGGTCCAGATGTGCATAGG + Intergenic
1063140209 10:3250025-3250047 ACAGGAGTCCATAGCTGAATAGG + Intergenic
1064647203 10:17471848-17471870 ACAGGACTCCACATCAGTTTAGG - Intergenic
1066455869 10:35571445-35571467 CCTGGATTCTACCTCTGTATAGG + Exonic
1066665645 10:37780570-37780592 CGAGGAGTCCTCACCTGTAGAGG - Intronic
1071226657 10:83538081-83538103 CCAGGAGTCCCAATTTGGATGGG + Intergenic
1076427292 10:130376511-130376533 AAAGGAGTCCACACCTGTATGGG - Intergenic
1078002137 11:7505533-7505555 CAAGAAGTCCACAACTGGATTGG + Intronic
1085265068 11:75232564-75232586 CCAGGTGTCCATATCTCTTTGGG + Intergenic
1085755691 11:79199619-79199641 CCAGGACTGCATATCTGTAATGG - Intronic
1086068098 11:82768024-82768046 CCTGGAGTCCCCATCTATAAAGG + Intergenic
1086426761 11:86692211-86692233 CCAGGATTCTCCATCTGTAATGG - Intergenic
1087807044 11:102566332-102566354 CCCTGAGTCCACATCTGAGTGGG - Intergenic
1087938170 11:104060265-104060287 CCAGGTGTCCACATATGCTTGGG + Intronic
1096492230 12:52019131-52019153 CCAGGAGTCCCCATCAGCCTGGG - Intergenic
1100103147 12:91134306-91134328 CCAGGAGTCAACAGCTGTGAAGG - Intergenic
1104104271 12:125644318-125644340 CCTGGAGTCCAGATCTTTGTGGG + Intronic
1107965140 13:45590961-45590983 CCAGAAGCCTACTTCTGTATTGG + Intronic
1112133839 13:96553428-96553450 CCAGAAGACCACAGCTGTCTAGG + Intronic
1113420653 13:110169430-110169452 CCAGTAACCCACATCTTTATTGG - Intronic
1122368305 14:101211904-101211926 CCAGTAGTTCACATCTTTATAGG + Intergenic
1122405804 14:101500263-101500285 CCAGGAGCCATCATCTGTAGAGG + Intergenic
1126931915 15:53662992-53663014 CCAGGAGTTCAAATCTGTAGTGG + Intronic
1134791421 16:16992567-16992589 CCAGGAGTTCACAGCTGCATTGG + Intergenic
1136569350 16:31087588-31087610 CAAGGAGCCCACATCTGCAGCGG - Exonic
1140452040 16:75078787-75078809 CCAGGAAGCAATATCTGTATTGG - Intronic
1144710120 17:17396018-17396040 CCAGGAGCCCACATTTCTCTAGG - Intergenic
1144891485 17:18496695-18496717 CCCAGAGGCCACATCTGTACTGG + Intergenic
1145140736 17:20447622-20447644 CCCAGAGGCCACATCTGTACTGG - Intergenic
1151511708 17:74564843-74564865 GCAGGAGGCCTCATCTATATGGG - Intergenic
1152606933 17:81296027-81296049 CCAGGAATCCACAGATCTATCGG - Intergenic
1155049018 18:22130320-22130342 CCAGGAGTTCACATCAGTCTGGG - Intergenic
1158967395 18:62634605-62634627 CCAAAAGTCCACATCTGTGTGGG + Intergenic
1161678365 19:5666136-5666158 CCCAGAGACCACATATGTATTGG + Intronic
1166898271 19:46037772-46037794 CCAGGGGTCCACATCTGGCAAGG + Intergenic
1167249634 19:48393198-48393220 CCAGGAGTCCCCTTCTCTACTGG - Intergenic
929451290 2:42039513-42039535 CCAGGAGTCTACAAATGTGTTGG - Intergenic
929976090 2:46636416-46636438 CCAGGAGTTCAAGACTGTATTGG - Intergenic
931494725 2:62790970-62790992 CCAGAAACCCACATCTATATTGG - Intronic
936029398 2:109059206-109059228 CCAGGAGTCCACAACATCATGGG + Intergenic
937702671 2:124881668-124881690 ACAGTAGTCCACAGCTGCATGGG + Intronic
938981580 2:136532152-136532174 GTAGGAGTCCACATCTGTTCTGG - Intergenic
941760796 2:169240852-169240874 CTATGAGTTCACATCTGTGTAGG - Intronic
947291604 2:228582124-228582146 CCAGGAGTCCTCAGCGGTATTGG + Intergenic
1170295080 20:14815198-14815220 CCAGGAAACCACATCTTTCTAGG - Intronic
1170584966 20:17727701-17727723 CCAAGAGTCAGCATCTTTATTGG - Intronic
1171936410 20:31278697-31278719 CCAGGAGTCCGGGTCTGTAGGGG + Intergenic
1182269149 22:29142608-29142630 CCAGGAGTCCGCACTTGTATGGG - Intronic
951624179 3:24642070-24642092 CCAAGAGTCCACAATTTTATTGG + Intergenic
951805406 3:26638432-26638454 CAAGGGATCCACAACTGTATAGG - Intronic
954801621 3:53190276-53190298 TCAGGATTCCCCATATGTATTGG - Intronic
957398824 3:79681683-79681705 CCAGGATTCCACATCTCCTTGGG - Intronic
965970499 3:174549364-174549386 CAAGGAGTCTACATCTGGCTTGG - Intronic
973045985 4:45534789-45534811 CCAGGATTCCTCAGCTGTAATGG - Intergenic
976045966 4:80948175-80948197 TAATGAGTCCACATCTGTGTTGG - Intronic
979431228 4:120634079-120634101 CCAGAAATCCACATGTATATAGG + Intergenic
981751013 4:148092307-148092329 CCTGCTGTCCACATCTTTATGGG + Intronic
985949455 5:3212338-3212360 ACAGGAGTGCACGTGTGTATAGG + Intergenic
986292327 5:6410248-6410270 ATGGGAGTCCACATCGGTATGGG - Intergenic
991951372 5:71949566-71949588 CCAGGACCTCACATCTGTAAGGG - Intergenic
992465008 5:76995408-76995430 CCAGGAGTTCAAAACTGTACTGG - Intergenic
993531905 5:89035517-89035539 TCAGGAGTCCAGACCAGTATAGG - Intergenic
997383203 5:133452025-133452047 CCAGGAGCCCACACCTGGCTGGG + Intronic
998828091 5:146126083-146126105 CCAGGATTCAACATTTGTATAGG - Intronic
999215076 5:149926312-149926334 CCAAGTGTCCATATATGTATGGG - Intronic
999256747 5:150213733-150213755 CTAGGCGTCCACATCTGGTTAGG - Intronic
999683474 5:154081640-154081662 CAGGGAGTCCCCATCTGTAGTGG + Intronic
1000503497 5:162083379-162083401 CAAGGAGTCCACAGATGGATAGG - Intronic
1001753719 5:174150459-174150481 CCAGGAGGGCACTTCTGTAAGGG + Intronic
1001821464 5:174713550-174713572 CCAGGATTCCAGATTTCTATGGG + Intergenic
1002592928 5:180303632-180303654 CCAGGTGGCAACATCTGGATGGG + Intronic
1005662105 6:28008923-28008945 CCTGGTGACCACCTCTGTATTGG - Intergenic
1011522086 6:88218843-88218865 ACAGGAGTCAAAATCTGTGTGGG + Intergenic
1013702253 6:112786890-112786912 CTAGGATTCCATATCTGTTTTGG + Intergenic
1013797720 6:113905462-113905484 CCAGGAGTTCACATCTATCCTGG - Intergenic
1014994283 6:128122963-128122985 CCAGGTGTTGACATCTGTTTCGG - Intronic
1015554749 6:134449880-134449902 CCAGGAGACCACATGTGCAAGGG - Intergenic
1020432917 7:8131926-8131948 GAAGCAGTCCACATCTGCATGGG - Intronic
1020467859 7:8501422-8501444 CCAGGAATCCACATTTTTAAAGG - Intronic
1027740073 7:81990438-81990460 CCAGGAGTTGAAATCTTTATAGG + Intronic
1035435057 7:158853431-158853453 CCTGGAGGCCTCATCTGCATGGG + Intergenic
1036277353 8:7367023-7367045 CCAAGATTCTAGATCTGTATTGG - Intronic
1037753037 8:21695118-21695140 CCAGGTGTGCACATCCGTGTAGG - Intronic
1037769847 8:21792059-21792081 CCTAGAGTCCAAATCTGCATGGG + Intronic
1037884099 8:22587321-22587343 CCAGGAGTCCAGACCAGTTTGGG + Intronic
1040325229 8:46338255-46338277 CCAGGAGTCCCCACCTGTCCCGG + Intergenic
1042684001 8:71417307-71417329 CCAGTAGTCCACAACAGTAGGGG + Intronic
1042984241 8:74565819-74565841 CCATGGTTCCACAGCTGTATAGG + Intergenic
1047629902 8:126695453-126695475 CCAGGAGGCCACAGCAGCATGGG - Intergenic
1047973576 8:130107922-130107944 TCAGGAGTTCACAGCTGTCTAGG + Intronic
1048144439 8:131826664-131826686 CCAGGAGTAAACATCATTATAGG - Intergenic
1048225461 8:132580993-132581015 CCAGGAGTCCACATCTGTATGGG - Intronic
1050569636 9:6924337-6924359 CCAGGGTTGCAGATCTGTATGGG + Intronic
1051685879 9:19657800-19657822 CCAGGAGTCCAAGTCTGCAGTGG - Intronic
1056025920 9:82495530-82495552 CCAGGAAGCCACATCCCTATGGG - Intergenic
1057805966 9:98220240-98220262 TCAGCATTCCACATCTGTAAAGG + Intronic
1062045961 9:134424668-134424690 CCAGTGTTCCACATCTGAATTGG - Intronic
1062065061 9:134522241-134522263 CCAGGTCTCCACCTCTGTCTGGG + Intergenic
1187190493 X:17030487-17030509 CTAGCAGCCCACATCTTTATGGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1195668122 X:107448996-107449018 CCAGGAGCCCACCTCAGTAAGGG - Intergenic
1195788797 X:108558737-108558759 CCAGGAAACCAGATCTGTAAGGG - Intronic
1197943511 X:131813984-131814006 CCAGGAGTTAACAGCTGTAGTGG + Intergenic
1201481118 Y:14440624-14440646 ACAGGAGTGAACATCTGTCTCGG - Intergenic