ID: 1048235243

View in Genome Browser
Species Human (GRCh38)
Location 8:132683451-132683473
Sequence CCAGGTCAGCTGCTCTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048235236_1048235243 -3 Left 1048235236 8:132683431-132683453 CCAGCCAGCACAGCCTCCCACCA No data
Right 1048235243 8:132683451-132683473 CCAGGTCAGCTGCTCTTGTATGG No data
1048235235_1048235243 -2 Left 1048235235 8:132683430-132683452 CCCAGCCAGCACAGCCTCCCACC No data
Right 1048235243 8:132683451-132683473 CCAGGTCAGCTGCTCTTGTATGG No data
1048235234_1048235243 7 Left 1048235234 8:132683421-132683443 CCAGAACGACCCAGCCAGCACAG No data
Right 1048235243 8:132683451-132683473 CCAGGTCAGCTGCTCTTGTATGG No data
1048235233_1048235243 18 Left 1048235233 8:132683410-132683432 CCTCAATGTGACCAGAACGACCC No data
Right 1048235243 8:132683451-132683473 CCAGGTCAGCTGCTCTTGTATGG No data
1048235238_1048235243 -7 Left 1048235238 8:132683435-132683457 CCAGCACAGCCTCCCACCAGGTC No data
Right 1048235243 8:132683451-132683473 CCAGGTCAGCTGCTCTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048235243 Original CRISPR CCAGGTCAGCTGCTCTTGTA TGG Intergenic
No off target data available for this crispr