ID: 1048235582

View in Genome Browser
Species Human (GRCh38)
Location 8:132686658-132686680
Sequence CAGTGGTGATAGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048235577_1048235582 -6 Left 1048235577 8:132686641-132686663 CCGGACTAGGAGGATAGCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG No data
1048235572_1048235582 15 Left 1048235572 8:132686620-132686642 CCCAGGTAGATCATGAGTCAGCC 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG No data
1048235573_1048235582 14 Left 1048235573 8:132686621-132686643 CCAGGTAGATCATGAGTCAGCCG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048235582 Original CRISPR CAGTGGTGATAGAGGGAAGT GGG Intronic
No off target data available for this crispr