ID: 1048235906

View in Genome Browser
Species Human (GRCh38)
Location 8:132690438-132690460
Sequence CTCACTGTTCGGCAAGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 506}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048235906_1048235912 18 Left 1048235906 8:132690438-132690460 CCCTACCCTTGCCGAACAGTGAG 0: 1
1: 0
2: 0
3: 24
4: 506
Right 1048235912 8:132690479-132690501 TTTATAAATTACCCAGTCTCAGG 0: 6401
1: 13084
2: 14111
3: 11019
4: 7181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048235906 Original CRISPR CTCACTGTTCGGCAAGGGTA GGG (reversed) Intronic
900077595 1:830293-830315 CTCAGTGTCTGGCAAGGGTTGGG - Intergenic
900117739 1:1035677-1035699 CTCCCTGTTCAGCAAGGGGTGGG + Intronic
900708992 1:4099468-4099490 CTCACAGTTCTGCATGGCTAGGG - Intergenic
900911893 1:5602671-5602693 CTCACAGTTCTGCACGGCTAGGG + Intergenic
904429540 1:30453175-30453197 CTCCCTGTTCTGCATGGTTATGG + Intergenic
905837145 1:41135561-41135583 CTCACAGTTCAGCATGGCTAGGG - Intronic
906069098 1:43004631-43004653 CTCACAGTTCTGCATGGCTAGGG + Intergenic
908407870 1:63832394-63832416 CTCACAGTTCTGCATGGGTGGGG + Intronic
908454712 1:64292001-64292023 CTCACAGTTCTGCATGGCTATGG + Intergenic
908564041 1:65336125-65336147 CTCACAGTTCAGCATGGCTAGGG + Intronic
909229182 1:73063030-73063052 CTCACAGTTCGGCATGGCTGGGG - Intergenic
909265852 1:73557693-73557715 CTCACAGTTCGGCATGGCTGGGG - Intergenic
910057087 1:83046031-83046053 CTCACAGTTCCCCATGGGTAGGG + Intergenic
910275594 1:85446197-85446219 CTCACTGTTCAACATGGCTAGGG + Intronic
910380074 1:86617023-86617045 CTCACAGTTCTGCATGGGTGGGG + Intergenic
911269959 1:95788997-95789019 CTCACAGTTCTGCATGGTTAGGG - Intergenic
911472666 1:98337450-98337472 CTGACAGTTCAGCATGGGTAGGG + Intergenic
912896096 1:113591509-113591531 CTCACTCTTTTGGAAGGGTACGG - Intronic
913596042 1:120378252-120378274 CTCACAGTTCGGCATGGCTGTGG + Intergenic
914091237 1:144500724-144500746 CTCACAGTTCGGCATGGCTGTGG - Intergenic
914307367 1:146433471-146433493 CTCACAGTTCGGCATGGCTGTGG + Intergenic
914594740 1:149139660-149139682 CTCACAGTTCGGCATGGCTGTGG - Intergenic
915504836 1:156347679-156347701 CTCACTCATCGCCAAGGGGATGG + Intronic
916904284 1:169264900-169264922 CTCACAGTTCAGCATGGCTAGGG + Intronic
917573256 1:176292642-176292664 CTCACTGTTCGCCAGTGATATGG + Intergenic
917587946 1:176446809-176446831 CTCTCTGTTCTGAAAGGGTGAGG - Intergenic
919371788 1:196737977-196737999 CTCACTGTTCTGCATGGCTGAGG + Intronic
919393956 1:197022023-197022045 CTCACAGTTCTGCATGGCTAAGG - Intergenic
921281897 1:213575625-213575647 CTCACAGTTCAGCATGGCTAGGG - Intergenic
921447555 1:215264379-215264401 CTCACAGTTCGGCATGGCTGGGG - Intergenic
921766107 1:218974016-218974038 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
921865090 1:220080477-220080499 CTCACAGTTCAGCATGGGTGGGG + Intronic
922098388 1:222461733-222461755 CTCACTGTTCCACAGGGCTAGGG - Intergenic
922357310 1:224788611-224788633 CTCACAGTTCGGCATGGCTAGGG - Intergenic
922370832 1:224909320-224909342 CTCACAGTTCTGCATGGCTAGGG + Intronic
1063153107 10:3354747-3354769 CTCACTGTTCTGCAGGGCTGGGG - Intergenic
1063296988 10:4816972-4816994 CTCACAGTTCTGCATGGGTGGGG + Intronic
1063696883 10:8344595-8344617 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1064181549 10:13120854-13120876 CTCACAGTTCAGCATGGCTAGGG + Intronic
1064361172 10:14666255-14666277 CTCACAGTTCTGCAGGGCTAGGG + Intronic
1064584036 10:16821910-16821932 CTCACTTATCACCAAGGGTATGG - Intergenic
1065094370 10:22266080-22266102 CTCACAGTTCGGCATGGCTGGGG - Intergenic
1065209481 10:23389006-23389028 CTCACAGTTCCACAAGGCTAGGG + Intergenic
1065233815 10:23626108-23626130 CTCACAGTTCTGCATGGCTATGG - Intergenic
1065392664 10:25199767-25199789 CTCACTGTTCTGCATGGCTGAGG - Intronic
1065995396 10:31055443-31055465 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1066440628 10:35435414-35435436 CACACTGTTCCCCAAGGGTATGG - Intronic
1066503444 10:36017271-36017293 CTCACAGTTCTGCATGGGTGGGG - Intergenic
1067956211 10:50794641-50794663 CTCAATGTCTGCCAAGGGTATGG + Intronic
1068422816 10:56819130-56819152 CTCACTGTTCAGCATGGCTGGGG + Intergenic
1069143625 10:64861069-64861091 CTTACAGTTCGGCATGGCTAAGG + Intergenic
1070068929 10:73066885-73066907 CTCACAGTTCCGCATGGCTACGG - Intronic
1070466735 10:76731478-76731500 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1071773399 10:88755850-88755872 CTCACAGTTCTGCAAGGCTGGGG + Intergenic
1071927765 10:90430429-90430451 CTCACAGTTCCGCAGGGCTAGGG - Intergenic
1073906359 10:108285258-108285280 CTCACGGTTCTGCATGGTTAGGG - Intergenic
1074481746 10:113828694-113828716 CTCACGGTTCCGCATGGCTAGGG + Intergenic
1074717686 10:116235033-116235055 CTCACAGTTCGGCATGGCTGGGG - Intronic
1074877459 10:117625258-117625280 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1075973587 10:126675285-126675307 TTCACTGTTCAGCAATGGGACGG + Intergenic
1076209731 10:128630663-128630685 CTCACAGTTCAGCAGGGCTACGG - Intergenic
1077396491 11:2326112-2326134 CTCACTGTTCTGCATGGCTGGGG + Intergenic
1078794136 11:14574763-14574785 CTCACAGTTCTGCATGGCTAAGG - Intronic
1079896568 11:26126711-26126733 CTCACTGTTCCGCATGGCTGGGG + Intergenic
1080113978 11:28601258-28601280 CTCACGGTTCAGCATGGCTAAGG - Intergenic
1080889016 11:36392647-36392669 CTCACAGTTCCGCATGGCTAGGG + Intronic
1081210712 11:40330563-40330585 CTCACTGTTCTGCATGGCTGGGG + Intronic
1081214160 11:40373684-40373706 CTCACTGATCACCAAGGGGATGG - Intronic
1081299183 11:41429259-41429281 CTCACAGTTCAGCATGGCTAGGG - Intronic
1081414163 11:42793320-42793342 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1081661119 11:44889093-44889115 CTCACAGTTAGGCATGGCTAGGG - Intronic
1082867839 11:57916121-57916143 CTCACTGTTCCACATGGCTAGGG - Intergenic
1084404755 11:68964998-68965020 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1085057896 11:73418294-73418316 CTCACTCATCAGCAAGGGGATGG - Intronic
1087255004 11:95943894-95943916 CTCACAGTTCTGCATGGGTGGGG - Intergenic
1090631342 11:128651852-128651874 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1090891120 11:130923230-130923252 CTCACAGTTCGGCATGGCTGGGG - Intergenic
1093219607 12:16403687-16403709 CTCACAGTTCAGCATGGCTAAGG + Intronic
1093306245 12:17523914-17523936 CTCACAGTTCGGCATGGCTGGGG - Intergenic
1095294488 12:40512801-40512823 CTCACAGTTCCACAAGGCTATGG + Intronic
1095308059 12:40661714-40661736 CTCACAGTTCTGCATGGGTGGGG - Intergenic
1097333259 12:58355243-58355265 CTCACAGTTCCGCATGGCTAGGG - Intergenic
1097487815 12:60228025-60228047 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1099404988 12:82248552-82248574 CTCACAGTTCTGCATGGCTAGGG + Intronic
1099487367 12:83245222-83245244 CTCACAGTTCTGCATGGCTAAGG + Intergenic
1099826811 12:87786197-87786219 CTCACAGTTCAGCAAGGCTGGGG - Intergenic
1099969899 12:89489901-89489923 CTCACTGCTAGGCAAGGGATGGG + Intronic
1100826261 12:98477366-98477388 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1101588292 12:106103931-106103953 CTCACAGTTCTGCAAGGCTGGGG - Intronic
1101692645 12:107095924-107095946 CTCACTGTTCAGCATGGCTGGGG - Intergenic
1102135044 12:110567219-110567241 CTCATTGTGCAGCAAGGGTGGGG - Intronic
1102627918 12:114250969-114250991 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1103114589 12:118315927-118315949 CTCACTGTGAGGTAATGGTATGG + Intronic
1104130812 12:125892116-125892138 CTCACAGTTCAGCATCGGTAGGG - Intergenic
1104189659 12:126467786-126467808 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1104588648 12:130067151-130067173 CTCACTCATCTCCAAGGGTAGGG - Intergenic
1105435764 13:20376946-20376968 TTCAATGTTCTGCAAGGGTTGGG - Intergenic
1105734473 13:23253779-23253801 CCCACTCTTCACCAAGGGTATGG - Intronic
1107589256 13:41884427-41884449 CTCACAGTTCTGCAAGGCTATGG - Intronic
1108253629 13:48590481-48590503 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1108731058 13:53236270-53236292 CTCACTGATCACCAAGGGGATGG - Intergenic
1109171791 13:59106632-59106654 CTCACAGTTCTGCAGGGCTAGGG - Intergenic
1110018723 13:70441698-70441720 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1110156197 13:72319851-72319873 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1110163059 13:72402449-72402471 CTCACTGTTCTGCAGGGCTGGGG + Intergenic
1110170292 13:72492236-72492258 CTCACAGTTCGGCATGGCTGGGG - Intergenic
1111038018 13:82704861-82704883 CTCACAGTTCCGCAAGGCTTGGG + Intergenic
1111365991 13:87245783-87245805 CTCACAGTTCCACATGGGTAGGG + Intergenic
1111778776 13:92695086-92695108 CTCACAGTTCTGCATGGCTAGGG - Intronic
1113205657 13:107912994-107913016 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1113302221 13:109034522-109034544 CTCACAGTTCAGCATGGCTAGGG - Intronic
1113568215 13:111333681-111333703 CTCACAGTTCTGCATGGCTAGGG + Intronic
1113645443 13:111991738-111991760 CTCACTGTTCTGCATGGCTGGGG - Intergenic
1114506117 14:23215270-23215292 CTCACAGTTCTGCACGGCTAGGG - Intronic
1114788173 14:25625119-25625141 CTCACAGTTCGGCATGGCTGGGG + Intergenic
1115533578 14:34351429-34351451 CTCACAGTTCAGCATGGCTAGGG + Intronic
1115942871 14:38628390-38628412 CTCACAGTTCAGCAAGGCTGGGG + Intergenic
1116107686 14:40531546-40531568 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1116551558 14:46246309-46246331 CTCACAGTTCTGCATGGCTATGG + Intergenic
1117480717 14:56141573-56141595 CTCACAGTTCGGCATGGCTGGGG + Intronic
1117820953 14:59648502-59648524 CTCAGTGTTCATCAAGGATATGG - Intronic
1118964882 14:70571487-70571509 CTCACAGTTCAGCATGGATAGGG - Intergenic
1120263643 14:82220970-82220992 CTCACAGTTCTGCATGGCTATGG + Intergenic
1120285329 14:82493300-82493322 CTCACAGTTCTGCATGGTTAAGG - Intergenic
1120404912 14:84083162-84083184 CTCACTGTTCTGCATGGCTGGGG + Intergenic
1120479641 14:85033954-85033976 CTCACAGTTCGGCATGGATGGGG - Intergenic
1120681880 14:87489888-87489910 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1120906684 14:89626800-89626822 CTCACAGTTCAGCATGGTTAGGG - Intergenic
1121818725 14:96948502-96948524 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1122008023 14:98721868-98721890 CTCACAGTTCAGCAAGGCTGGGG - Intergenic
1122730500 14:103793506-103793528 CTCACAGTTCTGCAAGGCTGGGG - Intronic
1124139296 15:27063438-27063460 CTCACTCATCAGCAAGGGGATGG - Intronic
1124436977 15:29658340-29658362 CTCACAGTTCTGCAAGGCTAGGG - Intergenic
1124556186 15:30728081-30728103 CTCACTGTTCAGCATGGTTGGGG + Intronic
1125146935 15:36481903-36481925 CTCACTGTTCAGCATGGCTGGGG + Intergenic
1125356619 15:38823078-38823100 CTCACAGTTCTGCACGGGTGGGG - Intergenic
1129091046 15:73151528-73151550 CTCACAGTTCTGCAGGGCTAGGG + Intronic
1129911484 15:79231029-79231051 CTCACTCATCGCCAAGGGGATGG + Intergenic
1130026239 15:80272901-80272923 CTCACAGTTCTGCAGGGCTAGGG - Intergenic
1130030682 15:80310821-80310843 CTCACAGTTCTGCAAGGCTGGGG + Intergenic
1131361459 15:91794556-91794578 CTCACAGTTCTGCATGGCTAAGG - Intergenic
1131829815 15:96347043-96347065 CTCACTGCCAGGCAAGGGAAGGG - Intergenic
1134111532 16:11518166-11518188 CTCACTGAAAGGCAAGGGGAGGG - Intronic
1134126577 16:11620286-11620308 CTCACTCATCAGCAAGGGGATGG - Intronic
1134784183 16:16925890-16925912 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1135785579 16:25346067-25346089 CTCACAGTTCTGCATGGGTGGGG + Intergenic
1137495232 16:48964347-48964369 CTCACAGTTCTCTAAGGGTAGGG + Intergenic
1137769100 16:51001522-51001544 TTCACAGTTCTGCAAGGCTAGGG - Intergenic
1138628625 16:58274691-58274713 CTCACAGTTCTGCATGGCTAGGG - Intronic
1139028635 16:62851267-62851289 CTCACAGTTCTGCAAGGCTGAGG - Intergenic
1139172646 16:64649995-64650017 CTCACAGTTCTGCAAGGCTGGGG + Intergenic
1140200427 16:72890374-72890396 CTCACAGTTCTGCAGGGGTGGGG - Intronic
1140772223 16:78215546-78215568 CTCACAGTTCCGCATGGCTAGGG - Intronic
1141505130 16:84471904-84471926 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1143099625 17:4498266-4498288 CACTCTGTGGGGCAAGGGTAGGG + Intergenic
1143425996 17:6838448-6838470 CTCACGGTTCAGCATGGCTAGGG + Intergenic
1147227654 17:38992424-38992446 CTAAATGTTAGGCAAAGGTATGG - Intergenic
1148049319 17:44761361-44761383 GTCTCTGTTCGGAAAGGGTCAGG - Intronic
1149125137 17:53220620-53220642 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1149973717 17:61245076-61245098 CTCACTGTTCTGCATGGCTGGGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150584557 17:66505567-66505589 CTGACAACTCGGCAAGGGTAAGG - Intronic
1150853795 17:68731425-68731447 CTCACAGTTCAGCACGGGTGAGG + Intergenic
1150938129 17:69659776-69659798 CTCACTCTTCACCAAGGGGATGG + Intergenic
1151014214 17:70535555-70535577 CTCACAGTTCCGCATGGCTAGGG + Intergenic
1152159692 17:78659837-78659859 CTCACAGTTCCGCATGGCTAGGG + Intergenic
1153914416 18:9733274-9733296 CTCACTGTTTGGGAAGAGGAAGG - Intronic
1155235543 18:23815453-23815475 CTCACTGTTCTGCAGGGAGATGG + Exonic
1155849194 18:30749484-30749506 CTCACAGTTCTGCAAGGCTGAGG - Intergenic
1156955001 18:42951893-42951915 CTCACAGTTCCGCATGGCTAAGG + Intronic
1157018989 18:43756474-43756496 CTCACTTATCACCAAGGGTATGG - Intergenic
1157302887 18:46492347-46492369 CTCACAGTTCTGCATGGCTAGGG + Intronic
1158182956 18:54738547-54738569 CTCACAGTTCTGCATGGGTGGGG - Intronic
1158222889 18:55168451-55168473 CTCACAGTTCAGCATGGGTGGGG - Intergenic
1158446791 18:57529105-57529127 CTCACTGGTCACCAAGGGGATGG + Intergenic
1158876466 18:61738966-61738988 CTCTCTGTTCAGCAAGAGTCAGG - Intergenic
1159455594 18:68657110-68657132 CTCACAGTTCTGCATGGGTGGGG + Intergenic
1159481354 18:68994730-68994752 CTCACAGTTCGGCATGGCTGGGG - Intronic
1159512173 18:69409222-69409244 CTCACAGTTCTGCATGGCTAGGG - Intronic
1159611596 18:70531770-70531792 CTCACAGTTCAGCATGGGTAGGG - Intergenic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1160347952 18:78150479-78150501 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
1160482982 18:79260167-79260189 CTCACAGTTCTGCATGGCTAAGG + Intronic
1160627359 18:80220081-80220103 CTCACAGTTCTGCAAGGCTGGGG + Intronic
1160743567 19:699321-699343 CTCACTGTGTGGCAGGGCTAAGG - Intergenic
1163230419 19:15998157-15998179 CTCACGTTTGGGCAAGGGTAGGG + Intergenic
1164429597 19:28175394-28175416 CTCACTGTTCTACATGGCTAAGG - Intergenic
1165120510 19:33555788-33555810 CTCACAGTTCAGCATGGTTAGGG + Intergenic
1165339685 19:35202220-35202242 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1165387726 19:35521232-35521254 CTCAATGACCGGCAAGGGGAGGG - Intergenic
1167964739 19:53133978-53134000 CTCACAGTTCCGCATGGCTAGGG - Intronic
925291822 2:2752890-2752912 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
925604725 2:5647600-5647622 CTCACAGTTCGGCATGGCTGTGG + Intergenic
925794794 2:7530183-7530205 CTCACAGTTCTGCATGGCTAAGG + Intergenic
926588884 2:14718717-14718739 CTCACTGTTCTGCATGGTTATGG - Intergenic
926841064 2:17080644-17080666 CTCACAGTTCAGCATGGGTGGGG - Intergenic
926919325 2:17925515-17925537 CTCACAGTTCCGCAGGGCTAGGG + Intronic
927025562 2:19065289-19065311 CTCACAGTTCTGCAGGGGTGGGG + Intergenic
927237236 2:20885400-20885422 CTCATAGTTCTGCAAGGCTAGGG - Intergenic
927362363 2:22250804-22250826 CTCACAGTTCAGCATGGCTAGGG + Intergenic
927424600 2:22968166-22968188 CTCACAGTTCCGCATGGCTAGGG + Intergenic
928360380 2:30657735-30657757 CTCACAGTTCAGCATGGCTAGGG + Intergenic
928757748 2:34546513-34546535 CTCACAGTTCAGCATGGCTAGGG - Intergenic
929260463 2:39861545-39861567 CTCACAGTTCTGCAAGGCTGAGG - Intergenic
929279905 2:40066451-40066473 CTCACAGTTCAGCATGGGTGGGG + Intergenic
930333493 2:50016493-50016515 CTCACAGTTCCGCAGGGCTACGG + Intronic
930675150 2:54192745-54192767 CTCACGGTTCTGCATGGCTAGGG + Intronic
931120675 2:59215718-59215740 CTCACAGTTCTGCATGGCTAGGG + Intergenic
931153225 2:59598321-59598343 CTCACAGTTCCGCATGGGTAGGG + Intergenic
931983892 2:67722903-67722925 CTCACAGTTCTGCATGGCTAGGG - Intergenic
933047045 2:77551965-77551987 CTCACAGTTCTGCATGGCTAGGG - Intronic
933083804 2:78029088-78029110 CTCACTGTTCTGCATGGCCAAGG - Intergenic
933117650 2:78495036-78495058 CTCACAGTTCTGCATGGCTAGGG + Intergenic
933838731 2:86267409-86267431 CTCACAGTTCTGCATGGCTAGGG - Intronic
935965092 2:108465025-108465047 CTCACTTTTCACCAAGGGAATGG + Intronic
936161683 2:110088094-110088116 CTCACAGTTCTGCATGGCTAGGG - Intronic
936182980 2:110283260-110283282 CTCACAGTTCTGCATGGCTAGGG + Intergenic
936739663 2:115490211-115490233 CTCACAGTTCTGCATGGCTAAGG + Intronic
936948705 2:117954978-117955000 CTCACAGTTTTGCATGGGTAGGG - Intronic
937584866 2:123534763-123534785 CTCACAGTTCTGCAGGGCTAGGG + Intergenic
938687734 2:133756803-133756825 CTCACTGTTCTGCAGGGCTGGGG + Intergenic
939247570 2:139645347-139645369 ATCTCTGTTCAGGAAGGGTAGGG + Intergenic
939396049 2:141631062-141631084 CTCACAGTTCTCCAAGGCTAGGG + Intronic
939605730 2:144253223-144253245 CTCACTGTTCTGCATGGCTGGGG - Intronic
939665026 2:144941155-144941177 CTCACAGTTCCGCAGGGCTAGGG + Intergenic
940649385 2:156426261-156426283 CTCACTGTTCAGCATGGCCAGGG + Intergenic
942592414 2:177560213-177560235 CTCACTCATCAGCAAGGGGATGG + Intergenic
942846279 2:180429511-180429533 CTCACAGTTCAGCATGGCTAAGG + Intergenic
942880572 2:180856717-180856739 CTCACAGTTCAGCATGGCTAGGG + Intergenic
942886988 2:180937777-180937799 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
943243405 2:185416235-185416257 CTCACTGGTAGGCATGGGAATGG + Intergenic
943302037 2:186215014-186215036 CTCACAGTTCAGCATGGCTAGGG + Intergenic
943327487 2:186518613-186518635 CTCACAGTTCAGCAAGGCTTGGG - Intergenic
944097091 2:195980376-195980398 CTCACAGTTCTGCAAGGCTGGGG - Intronic
945021147 2:205572934-205572956 CTCACAGTTCAGCATGGCTAGGG + Intronic
945359994 2:208885770-208885792 CTCACAGTTCCACATGGGTAGGG - Intergenic
946472375 2:219974271-219974293 CTCACAGTTCTGCAGGGTTAGGG + Intergenic
946499891 2:220236334-220236356 CTCACAGTTCTGCAAGGTTGGGG - Intergenic
946931454 2:224675589-224675611 CTCACAGTTCGGCATGGCTGGGG + Intergenic
947076312 2:226349592-226349614 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1169938145 20:10906898-10906920 CTCACTTTTAGGCAAGGTCATGG - Intergenic
1173989924 20:47294024-47294046 CTCACAGTTCTGCATGGCTAGGG - Intronic
1175070896 20:56332878-56332900 CTCACTCATCACCAAGGGTATGG - Intergenic
1175376314 20:58527105-58527127 CTCACAGTTCAGCAAGGCTGGGG + Intergenic
1175603291 20:60292371-60292393 CTCACAGTTCAGCAAGGCTGCGG - Intergenic
1176723304 21:10410704-10410726 CTCGCTGATCGCCAAGGGGATGG - Intergenic
1176954797 21:15089245-15089267 CTCACTGTTCTGCATGGCTGGGG - Intergenic
1177513247 21:22117303-22117325 CTCACAGTTCAGCATGGGTCAGG + Intergenic
1177539379 21:22471765-22471787 CTCACAGTTCGGCATGGCTGGGG - Intergenic
1177765374 21:25451205-25451227 CTCACAGTTCTGCATGGTTAGGG + Intergenic
1178043071 21:28662787-28662809 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
1178505731 21:33161514-33161536 CTCACTTATCACCAAGGGTATGG - Intergenic
1178798346 21:35766807-35766829 CTCACAGTTCAGCATGGCTAGGG + Intronic
1179074481 21:38107164-38107186 CTCACAGTTCGGCATGGCTGGGG + Intronic
1179339383 21:40490004-40490026 CTCACTGTTCCACATGGCTAGGG + Intronic
1179484653 21:41702143-41702165 CTCACAGTTCAGAATGGGTAAGG + Intergenic
1179793973 21:43771680-43771702 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1183018060 22:35006275-35006297 CCCACTGTTGGGCAAGGAGAAGG - Intergenic
949354106 3:3159098-3159120 CTCACAGTTCAGCATGGCTAGGG - Intronic
949420851 3:3864394-3864416 CTCACAGTTCAGCAAGGCTGGGG + Intronic
949640510 3:6030692-6030714 CTCACAGTTCTGCAATGCTAGGG + Intergenic
949808967 3:7985473-7985495 CTCACAGTTCCTCAAGGCTATGG - Intergenic
950043859 3:9937543-9937565 CTCACTGATCGGACAGGGCAGGG - Exonic
950525723 3:13521903-13521925 CTCACAGTTCTGCATGGCTAAGG + Intergenic
950589467 3:13925864-13925886 CTCACAGTTCTGCAGGGCTAGGG - Intergenic
950917636 3:16662252-16662274 CTCACTGTTCAGCATGGCTAGGG - Intronic
951255647 3:20446355-20446377 CTCACTGTTCTGCAGGGCTGAGG - Intergenic
951865958 3:27308075-27308097 CTCACAGTTCAGCATGGCTAGGG + Intronic
952208620 3:31206002-31206024 CTCACTGTTCTGCAGGGCTGGGG + Intergenic
952611354 3:35214662-35214684 CTCACTGTTCTGCATGGCTAGGG + Intergenic
952622012 3:35356377-35356399 CTCACAGTTCGGCATGGCTAGGG + Intergenic
953379223 3:42454428-42454450 CTCACAGTTCTGCATGGCTAGGG + Intergenic
956281233 3:67559342-67559364 CTCACTGTTCCGCATGGCTGGGG + Intronic
956856001 3:73275461-73275483 CTCACAGTTCTGCATGGATAGGG + Intergenic
956947193 3:74236011-74236033 CTCACAGTTCAGCATGGCTAGGG + Intergenic
957166157 3:76676387-76676409 CTCACAGTTCTGCAGGGCTAGGG - Intronic
957199851 3:77119189-77119211 CTCACTGTTCTGCATGGCTGGGG - Intronic
957300794 3:78389365-78389387 CTCACAGTTCAGCATGGCTAGGG - Intergenic
958005935 3:87812043-87812065 CTCACAGTTCTGCATGGCTAGGG - Intergenic
958649930 3:96926097-96926119 CTCACAGTTCCACATGGGTAGGG + Intronic
959405150 3:105952657-105952679 CTCACAGTTCCGCATGGCTAGGG + Intergenic
959728103 3:109568685-109568707 GTTACTGCTGGGCAAGGGTAGGG + Intergenic
959808889 3:110592800-110592822 CTCACTGTTCTGCAGGGCTGGGG - Intergenic
959914315 3:111798948-111798970 CTCACAGTTCAGCATGGCTAGGG + Intronic
960136227 3:114108325-114108347 CTCACTGATCACCAAGGGTTTGG + Intergenic
962066881 3:131991039-131991061 CTCACAGTTCGGCATGGGGAAGG - Intronic
963006898 3:140734843-140734865 CTCACAGTTCTGCATGGCTAGGG - Intergenic
963255536 3:143140873-143140895 CTCACAGTTCCGCATGGCTAGGG - Intergenic
963296987 3:143557264-143557286 CTCACAGTTCTGCAAGGCTGAGG - Intronic
964127597 3:153252059-153252081 CTCACTGATCACCAAGGGGATGG + Intergenic
964870062 3:161303700-161303722 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
965224491 3:165971336-165971358 CTCACAGTTCAGCATGGGTGGGG - Intergenic
965387061 3:168057426-168057448 CTCACAGTTCCGCATGGCTAGGG + Intronic
967048132 3:185756116-185756138 CTCACTCTTCAGTAAGGGTATGG - Intronic
967210810 3:187166886-187166908 CTCACTGTTCCACATGGCTAGGG + Intronic
968212336 3:196859454-196859476 CTCACAGTTCTGCAAGGCTGGGG + Intergenic
970047946 4:11877061-11877083 CTCACTGTTCTGCATGGCTGGGG + Intergenic
970628525 4:17916409-17916431 CTCACTTATCAGCAAGGGGATGG - Intronic
970939113 4:21610750-21610772 CTCACTTTTCTGCATGGGTGGGG + Intronic
971069816 4:23079167-23079189 CTCACTGTTCTGCACGGCTGGGG + Intergenic
971591249 4:28472297-28472319 CTCACAGTTCGGAATGGCTAGGG - Intergenic
971744741 4:30565506-30565528 CTCACAGTTCAGCATGGCTAGGG - Intergenic
971962673 4:33508607-33508629 CTCACAGTTCTGCATGGCTAGGG - Intergenic
971972110 4:33634074-33634096 CTCACAGTTCGGCATGGCTGTGG - Intergenic
972054210 4:34779860-34779882 CTCACAGTTCTGCATGGCTAGGG + Intergenic
972129109 4:35807966-35807988 CTCACAGTTCTGCATGGCTAGGG + Intergenic
972131149 4:35835059-35835081 CTCTGTATTCGGCAAGGGGAAGG - Intergenic
972211916 4:36848707-36848729 CTCACTTATCACCAAGGGTATGG - Intergenic
972566480 4:40273782-40273804 CTCACCGAGTGGCAAGGGTATGG + Intergenic
972823454 4:42729202-42729224 CTCACAGTTCTGCATGGCTAGGG + Intergenic
973012339 4:45092719-45092741 CTCACTGATCACCAAGGGGATGG + Intergenic
973790633 4:54374819-54374841 CTCACCGTTCGGAAAGGATCTGG + Intergenic
973930224 4:55785058-55785080 CTCACAGTTCTGCATGGCTAGGG - Intergenic
974125560 4:57692036-57692058 CTCACTGTTCAGCATGGCTGGGG - Intergenic
974344523 4:60661950-60661972 CTCACAGTTCTGCATGGCTAGGG - Intergenic
974617858 4:64313006-64313028 CTCACAGTTCCGCAAGGCTGGGG - Intronic
974728757 4:65834200-65834222 CTCACAGTTCAGCATGGCTAGGG + Intergenic
975052415 4:69882662-69882684 CTCACAGTTCTGCATGGCTAGGG + Intergenic
976701704 4:87976662-87976684 TTCACTATTAGGCAAGGGAAAGG - Intronic
977016075 4:91694326-91694348 CTCACTGTTCTGCATGGCTGGGG - Intergenic
977382388 4:96292379-96292401 CTCACAGTTCTGCATGGGTTGGG + Intergenic
977505343 4:97895678-97895700 CTCACTGATAGACAAGGGAAGGG - Intronic
977656562 4:99528615-99528637 CTCACAGTTCTGCATGGCTAGGG + Intronic
978235056 4:106447708-106447730 CTCACAGTTCGACATGGGTGGGG + Intergenic
978929629 4:114294974-114294996 CTCACAGTTCTGCATGGCTAGGG - Intergenic
979073821 4:116244844-116244866 CTCACAGTTCAGCATGGCTAGGG - Intergenic
980775344 4:137429801-137429823 CTCACTTATCACCAAGGGTATGG - Intergenic
981809372 4:148756238-148756260 CTCACAGTTCCGCATGGCTAGGG + Intergenic
981834246 4:149036718-149036740 CTCACAGTTCCGCAAGGCTGGGG - Intergenic
982799893 4:159692469-159692491 CTCACAGTTCTGCAAGGCTAGGG - Intergenic
983298148 4:165891990-165892012 CTCACTGTTCAGCATGGCTGAGG + Intronic
983636087 4:169899165-169899187 CTCACAGTTCCGCATGGCTAGGG - Intergenic
983825018 4:172248873-172248895 CTCACAGTTCCACAGGGGTAGGG - Intronic
984008312 4:174340496-174340518 CTCACAGTTCAGCATGGCTAGGG + Intergenic
984214223 4:176888103-176888125 CTCACTGTTCAGCATGGCTGGGG - Intergenic
984636561 4:182116610-182116632 CTCACAGTTCCGCATGGGTGGGG - Intergenic
986529761 5:8724065-8724087 CTCACAGTTCTGCATGGCTAGGG - Intergenic
986533519 5:8762732-8762754 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
986640467 5:9867353-9867375 CTCACAGTTCGGCATGGCTGGGG + Intergenic
986647710 5:9934254-9934276 CTCACAGTTCAGCAGGGCTAGGG + Intergenic
986752004 5:10795543-10795565 CTCACAGTTCTGCATGGCTAGGG - Intergenic
986896581 5:12377959-12377981 CTCACTGTTAGGAAAGTATACGG - Intergenic
986995681 5:13604528-13604550 CTCACAGTTCTGCATGGCTAGGG - Intergenic
987560297 5:19511236-19511258 CTCACAGTTCAGCATGGCTAGGG - Intronic
987585154 5:19844479-19844501 CTCACAGTTCCGCAAAGCTAAGG - Intronic
987726970 5:21715975-21715997 CTCACAGTTCAGCATGGCTATGG + Intergenic
988057964 5:26125084-26125106 CTCACAGTTCAGCATGGCTAGGG + Intergenic
988119450 5:26942087-26942109 CTCACAGTTCAGCAAGGCTAGGG + Intronic
988230175 5:28466474-28466496 CTCACAGTTCAGCATGGCTAGGG - Intergenic
988275913 5:29080806-29080828 CTCACAGTTCTGCATGGCTAGGG - Intergenic
988324280 5:29741717-29741739 CTCACAGTTCTGCATGGCTATGG + Intergenic
988417115 5:30959412-30959434 CTCACTCATCACCAAGGGTATGG - Intergenic
988691822 5:33580250-33580272 CTCACAGTTCTGCATGGGTGGGG + Intronic
989121318 5:38007399-38007421 CTCACAGTTCAGCATGGCTAGGG + Intergenic
989646465 5:43638201-43638223 CTCACAGTTCTGCAAGGCTGGGG - Intronic
989690046 5:44131228-44131250 CTCACAGTTCGGCATGGCTGGGG - Intergenic
991085994 5:62648683-62648705 CACACTGATGGGCAAGGGTGAGG + Intergenic
991120465 5:63007901-63007923 CTCACAGTTCTGCATGGCTAGGG + Intergenic
991126219 5:63072577-63072599 CTCACTGTTCAGCATGGCTGGGG - Intergenic
991136468 5:63187445-63187467 CTCACTGATCACCAAGGGGATGG + Intergenic
993168303 5:84384302-84384324 CCCCCAGTTCGGCAAAGGTAAGG - Exonic
993352669 5:86869084-86869106 CTCACAGTTCTGCATGGCTACGG + Intergenic
993419149 5:87678554-87678576 CTTACTGTTCTGCAAGGCAATGG - Intergenic
993967018 5:94371436-94371458 CTCACTGTTCTGCAGGGCTGGGG + Intronic
994254002 5:97571105-97571127 CTCACAGTTCCGCATGGCTAGGG + Intergenic
994539007 5:101070963-101070985 CTCACAGTTCCGCATGGCTAGGG + Intergenic
994926368 5:106121737-106121759 CTCACTCATCACCAAGGGTATGG + Intergenic
995390856 5:111639125-111639147 CTCACAGTTCTGCATGGCTAGGG - Intergenic
995391137 5:111641036-111641058 CTCACAGTTCTGCATGGCTAGGG - Intergenic
995981709 5:118112332-118112354 CTCACAGTTCAGCACGGATAAGG - Intergenic
997101918 5:130979523-130979545 CTCACAGTTCAGCAAGGCTAGGG + Intergenic
997180812 5:131826823-131826845 CTCACTGTTCTGCATGGCTGGGG - Intronic
997656214 5:135556648-135556670 CTCACAGTTCCGCATGGCTAGGG + Intergenic
998609295 5:143670674-143670696 CTCACTCATCGCCAAGGGGATGG + Intergenic
998756791 5:145390349-145390371 CTCACAGTTCAGCATGGCTACGG + Intergenic
998774342 5:145582260-145582282 CTCACAGTTCTGCAGGGCTAAGG + Intronic
998872811 5:146569379-146569401 CTCACAGTTCTGCATGGCTAGGG - Intergenic
999969406 5:156844369-156844391 CTCACAGTTCTGCAAGGCTGGGG + Intergenic
1000686402 5:164255024-164255046 CTCACTGTTCCGCATGGCTGGGG - Intergenic
1000741949 5:164979563-164979585 CTCACAGTTCTGCATGGGTGGGG + Intergenic
1000744029 5:165007969-165007991 CTCACAGTTCAGCATGGATAGGG - Intergenic
1001282851 5:170400257-170400279 CTCACAGTTCTGCATGGCTAGGG + Intronic
1001889250 5:175325284-175325306 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
1001918433 5:175581395-175581417 CTCATTGTTCAGCATGGCTAGGG + Intergenic
1002958070 6:1888290-1888312 CTCACAGTTCAGCAAGGCTGGGG + Intronic
1003227556 6:4219919-4219941 CTCACAGTTCTGCAGGGCTAGGG + Intergenic
1003281592 6:4697329-4697351 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1003462443 6:6342418-6342440 CTCACAGTTCTGCATGGTTAGGG - Intergenic
1005121367 6:22392873-22392895 CTCACTCATCGCCAAGGGGATGG + Intergenic
1005345413 6:24884585-24884607 CTCACTCCTCAGCAAGGGGATGG + Intronic
1005783550 6:29218635-29218657 CTCACAGTTCCGCAAGGCTGGGG - Intergenic
1007179333 6:39917179-39917201 CTCACAGTTCAGCATGGTTAGGG + Intronic
1007529056 6:42524543-42524565 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1008015205 6:46510903-46510925 CTCAGTGTTCTGCATGGGTCAGG + Intergenic
1008025069 6:46626987-46627009 CTCACAGTTCTGCATGGGTGGGG + Intronic
1009377668 6:62991828-62991850 CTCACAGTTCCGCAAGGCTGGGG + Intergenic
1009391081 6:63144878-63144900 CTCACAGTTCGGCATGGCTGGGG - Intergenic
1009451492 6:63805879-63805901 CTCACTGTTCAGCATGGCTGGGG - Intronic
1009468623 6:64003948-64003970 CTCACAGTTCGGCATGGCTGGGG - Intronic
1009473105 6:64052882-64052904 CTCACAGTTCGGCATGGCTGGGG - Intronic
1009528342 6:64776953-64776975 CTCACAGTTCGGCATGGCTGCGG + Intronic
1009546140 6:65021772-65021794 CTCACTGTTCAGCATGGCTGTGG + Intronic
1009614917 6:65991466-65991488 CTCACAGTTCTGCAGGGCTAGGG + Intergenic
1009787566 6:68358802-68358824 CTCAATGTCCAGCAAGGGTAGGG + Intergenic
1011199020 6:84814352-84814374 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
1011409142 6:87048194-87048216 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1011889212 6:92135762-92135784 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1011956521 6:93030803-93030825 CTCACAGTTCAGCATGGGTGGGG + Intergenic
1012076416 6:94692025-94692047 CTCACAGTTCGGCATGGCTGGGG + Intergenic
1012638831 6:101582514-101582536 CTCACAGTTCTGCAAGGCTGAGG - Intronic
1012810268 6:103948325-103948347 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1013402461 6:109812194-109812216 CTCACAGTTCAGCATGGCTAGGG - Intronic
1013661077 6:112297718-112297740 CTCACAGTTCCGCATGGCTAGGG + Intergenic
1013723973 6:113069640-113069662 CTCACTGTTCAGCATGGCTGGGG + Intergenic
1013904279 6:115197531-115197553 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1013976124 6:116080964-116080986 CTCACTGTTCAGCATGGCTGGGG + Intergenic
1014330600 6:120059202-120059224 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1014647261 6:123989980-123990002 CTCACAGTTCTGCATGGCTAGGG + Intronic
1015298243 6:131623779-131623801 CTCACAGTTTGGCATGGCTAGGG - Intronic
1016008028 6:139109082-139109104 CTCACAGTTCAGCAAGGCTAGGG - Intergenic
1016021079 6:139236601-139236623 CTCACTGTTCTGCATGGCTTGGG - Intergenic
1016437235 6:144049465-144049487 CTCACAGTTCTGCACGGCTAGGG + Intronic
1017794981 6:157835792-157835814 CTCACAGTTCAGCATGGCTAGGG - Intronic
1018280930 6:162184615-162184637 CTCACAGTTCCGCATGGCTAGGG - Intronic
1018477835 6:164160483-164160505 CTCACAGTTCTGCAGGGCTAGGG + Intergenic
1018517271 6:164598180-164598202 CTCACAGTTCTGCATGGGTGGGG + Intergenic
1019199438 6:170302142-170302164 CTCACAGTTCAGCATGGTTAGGG + Intronic
1019359588 7:597899-597921 CTCACTGTGCTGCAAGAGTTGGG - Intronic
1019496559 7:1343183-1343205 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1020729567 7:11865099-11865121 CTCACAGTTCTGCAGGGCTAGGG - Intergenic
1021056609 7:16056092-16056114 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1021787038 7:24162859-24162881 CTCACAGTTCCGCATGGCTAAGG - Intergenic
1022598906 7:31738299-31738321 CTCACAGTTCCGCATGGGTGGGG + Intergenic
1023127926 7:36973845-36973867 CTCATTGCTCGGCAACGGCAGGG - Intronic
1023854395 7:44173271-44173293 CTCACTGCTCAGCAATGGCAAGG + Intronic
1024756956 7:52544885-52544907 ATCAATGGTTGGCAAGGGTAAGG - Intergenic
1026165600 7:67906406-67906428 CTCACAGTTCCACAAGGCTAGGG + Intergenic
1026278501 7:68901378-68901400 CTCACAGATCTGCAAGGGTGTGG + Intergenic
1026655534 7:72253458-72253480 CTCACAGTTCTGCATGGCTAAGG + Intronic
1026942321 7:74294254-74294276 CTCACTGGGCTGCAAGGCTAGGG + Intronic
1027476741 7:78641141-78641163 CTCACAGTTCTGCAGGGCTAGGG - Intronic
1027586550 7:80065752-80065774 CTCACTTTTCATCAAGGGGATGG + Intergenic
1027592135 7:80130924-80130946 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1028371482 7:90097626-90097648 CTCACTGTTCTGCATGGCTGGGG + Intergenic
1028438432 7:90831225-90831247 CTCACAGTTCAGCAAGGGTGGGG + Intronic
1030357594 7:108559669-108559691 CTCACAGTTCTGCATGGCTAGGG + Intronic
1030914499 7:115295813-115295835 CTCACAGTTCTGCATGGTTAGGG - Intergenic
1031074047 7:117195528-117195550 CTCACAGTTCAGCATGGCTAGGG + Intronic
1031175613 7:118344944-118344966 CTCACTGTTCTGCAATGTTGAGG + Intergenic
1031806667 7:126316086-126316108 CTCACAGTTCTGCATGGGTGAGG + Intergenic
1031808036 7:126330328-126330350 CTCACTGTTCTGCATGGGTGGGG - Intergenic
1031992043 7:128204847-128204869 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032422073 7:131790133-131790155 CTCACAGTTCTGCAGGGCTACGG - Intergenic
1032440486 7:131939062-131939084 CTCACAGTTCCGCATGGCTAGGG - Intergenic
1032894604 7:136236628-136236650 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1033080792 7:138295156-138295178 CTCACTGTTCAGCATGGCTAGGG - Intergenic
1034001260 7:147415587-147415609 CTCACAGTTCAGCATGGCTAGGG - Intronic
1034874641 7:154714451-154714473 CTCACGGTTCTGCATGGCTAGGG + Intronic
1035369088 7:158367414-158367436 CTCACTGGTGGGAAAGGGAAAGG + Intronic
1035528030 8:329343-329365 CTCAGTGTCTGGCAAGGGTTGGG + Intergenic
1035597975 8:875582-875604 CTCACAGTTCAGCAGGGCTAGGG - Intergenic
1036457419 8:8922187-8922209 CTCACTGTTCTGCATGGCTAGGG - Intergenic
1036990801 8:13591512-13591534 CTCACGGTTCTGCATGGCTAGGG - Intergenic
1037024072 8:14010504-14010526 CTCACAGTTCCACATGGGTAGGG + Intergenic
1037384369 8:18321994-18322016 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1038346803 8:26740589-26740611 CTCACAGTTCTGCATGGGTGGGG - Intergenic
1038888301 8:31690210-31690232 CTCACAGTTCAGCATGGCTAGGG - Intronic
1038936556 8:32258531-32258553 CTCACAGTTCTGCATGGCTAGGG + Intronic
1040721563 8:50330317-50330339 CTCACAGTTCAGCAAGGCTGGGG - Intronic
1040741218 8:50578791-50578813 CTCACAGTTCAGCACGGCTAGGG - Intronic
1041166463 8:55097335-55097357 CTCACAGTTCTGCAGGGCTAGGG - Intergenic
1041656264 8:60353379-60353401 CTCACAGTTCTGCATGGGTGGGG - Intergenic
1042472425 8:69206544-69206566 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1042971235 8:74411164-74411186 CTCACAGTTCGGCATGGCTGGGG - Intronic
1043101871 8:76057812-76057834 CTCACTTTTCACCAAGGGGACGG - Intergenic
1043309368 8:78839201-78839223 CTCACAGTTCCGCAGGGCTAGGG + Intergenic
1043772270 8:84219387-84219409 CTCACAGTTCAGCATGGCTAGGG - Intronic
1044144875 8:88700368-88700390 CTCACAGTTCCTCAGGGGTAGGG - Intergenic
1045726752 8:105182885-105182907 CTCACTTTTCACCAAGGGGATGG - Intronic
1045776763 8:105813097-105813119 CTCACAGTTCAGCAAGGGCTGGG + Intergenic
1046506607 8:115145685-115145707 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1046835410 8:118795493-118795515 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1046917542 8:119693051-119693073 CTCACAGTTCCGCAAGGCTGGGG - Intergenic
1047079990 8:121449180-121449202 CTCACTGTTCCACAGGGCTAGGG + Intergenic
1047116134 8:121843320-121843342 CTCACAGTTCAGCATGTGTAGGG - Intergenic
1048019304 8:130523686-130523708 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1048235906 8:132690438-132690460 CTCACTGTTCGGCAAGGGTAGGG - Intronic
1050606824 9:7310390-7310412 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1050679182 9:8090066-8090088 CTCACAGTTCAGCATGGCTAGGG - Intergenic
1050777820 9:9288974-9288996 CTCACAGTTCGGCAGGGCTGGGG - Intronic
1051483733 9:17586567-17586589 CTCACAGTTCTGCATGGCTAGGG + Intronic
1052127944 9:24801784-24801806 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1052174071 9:25435233-25435255 CTCACTGTTCTGCATGGCTGGGG + Intergenic
1052666176 9:31497787-31497809 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1053356120 9:37447119-37447141 CTCACAGTTCTGCATGGCTAAGG + Intronic
1054852736 9:69865223-69865245 CTCACAGTTCGGCATGGCTGGGG - Intronic
1054868453 9:70026532-70026554 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1057462163 9:95272925-95272947 TTCACTGTCCGGCAAAGGTGTGG + Intronic
1057893249 9:98885442-98885464 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1057982897 9:99680012-99680034 CTCACAGTTCTGCAAGGCTGGGG - Intergenic
1058104144 9:100950790-100950812 CACACTCTTGGGCAAGGGGAGGG + Intergenic
1058906585 9:109486969-109486991 CTCACAGTTCCGCAAGGCTGGGG - Intronic
1059796087 9:117698411-117698433 CTCACTGTTCTGCAAGGCTGGGG - Intergenic
1060260078 9:122066804-122066826 CTCACAGTTCAGCATGGCTAGGG + Intronic
1061429462 9:130522168-130522190 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1061754463 9:132802979-132803001 CTCACAGTTCTGCAAGGCTGGGG + Intronic
1186381651 X:9067283-9067305 CTCACAGTTCTGCATGGCTAGGG + Intronic
1187711804 X:22061909-22061931 CTCACAGTTCTGCATGGCTAGGG + Intronic
1188513539 X:30961392-30961414 CTCACAGTTCTGCATGGCTAGGG - Intronic
1188651633 X:32637627-32637649 CTCACAGTTCGGCATGGCTGGGG + Intronic
1188753990 X:33937554-33937576 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1189257311 X:39650587-39650609 CTCACAGTTCAGCAAGGCTGGGG - Intergenic
1191600741 X:63002449-63002471 CTCACTTTTCACCAAGGGGATGG - Intergenic
1193042979 X:77023601-77023623 CTCACAGTTCAGCATGGCTATGG + Intergenic
1193534662 X:82699050-82699072 CTCACAGTTCGGCATGGCTGGGG - Intergenic
1195325981 X:103758887-103758909 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1195824587 X:108984352-108984374 CTCACTGTTCCGCATGGCTGGGG - Intergenic
1196380011 X:115078874-115078896 CTCACAGTTCCACATGGGTAGGG - Intergenic
1196834921 X:119804846-119804868 CTCACAGTTCCACATGGGTAGGG + Intergenic
1196864158 X:120055602-120055624 CTCACTGTTCTGCATGGCTGGGG - Intergenic
1196878941 X:120180728-120180750 CTCACTGTTCTGCATGGCTGGGG + Intergenic
1197004419 X:121479682-121479704 CTCACTGTTCCGCATGGCTGGGG - Intergenic
1198439602 X:136650342-136650364 CTCACAGTTCAGTAAGGATAAGG - Exonic
1198991663 X:142521460-142521482 CTCACAGTTCTGCAGGGCTAGGG + Intergenic
1199182611 X:144876434-144876456 CTCACAGTTCAGCATGGCTAGGG + Intergenic
1199466676 X:148145819-148145841 CTCACTTTGAGGCAAGGGGATGG - Intergenic
1201419861 Y:13786817-13786839 CTCACAGTTCCGCATGGCTAAGG + Intergenic
1201440023 Y:13998349-13998371 CTCACAGTTCTGCATGGCTAGGG + Intergenic
1201444548 Y:14044359-14044381 CTCACAGTTCTGCATGGCTAGGG - Intergenic
1201703353 Y:16908350-16908372 CTCACAGTTCTGCAAGGATGGGG + Intergenic