ID: 1048237112

View in Genome Browser
Species Human (GRCh38)
Location 8:132701656-132701678
Sequence CACTTTATCCAAAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 197}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048237112_1048237117 22 Left 1048237112 8:132701656-132701678 CCTGCTTCCCTTTGGATAAAGTG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1048237117 8:132701701-132701723 TGGCCATCTTGCCCCCAGGTTGG No data
1048237112_1048237115 2 Left 1048237112 8:132701656-132701678 CCTGCTTCCCTTTGGATAAAGTG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1048237115 8:132701681-132701703 TTTAAAACTAACTTATTGTGTGG No data
1048237112_1048237121 28 Left 1048237112 8:132701656-132701678 CCTGCTTCCCTTTGGATAAAGTG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1048237121 8:132701707-132701729 TCTTGCCCCCAGGTTGGGGATGG No data
1048237112_1048237118 23 Left 1048237112 8:132701656-132701678 CCTGCTTCCCTTTGGATAAAGTG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1048237118 8:132701702-132701724 GGCCATCTTGCCCCCAGGTTGGG No data
1048237112_1048237122 29 Left 1048237112 8:132701656-132701678 CCTGCTTCCCTTTGGATAAAGTG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1048237122 8:132701708-132701730 CTTGCCCCCAGGTTGGGGATGGG No data
1048237112_1048237116 18 Left 1048237112 8:132701656-132701678 CCTGCTTCCCTTTGGATAAAGTG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1048237116 8:132701697-132701719 TGTGTGGCCATCTTGCCCCCAGG No data
1048237112_1048237119 24 Left 1048237112 8:132701656-132701678 CCTGCTTCCCTTTGGATAAAGTG 0: 1
1: 0
2: 2
3: 19
4: 197
Right 1048237119 8:132701703-132701725 GCCATCTTGCCCCCAGGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048237112 Original CRISPR CACTTTATCCAAAGGGAAGC AGG (reversed) Intronic
902740492 1:18434500-18434522 AACTTTAGGCTAAGGGAAGCAGG + Intergenic
903227701 1:21903193-21903215 CACTTCATCCTAAGGGAAAGAGG + Intronic
903450614 1:23451547-23451569 CAATTTGCCCAGAGGGAAGCTGG + Intronic
905382793 1:37575339-37575361 CACAGGATCCAAAGGGAAGCAGG - Intronic
906266569 1:44435525-44435547 CTCTTTATCCCAAGGAACGCTGG - Intronic
906426128 1:45714354-45714376 CACTTCCTCCAATGGGAACCAGG - Exonic
906545546 1:46616982-46617004 TCCTTTGTCCAAGGGGAAGCTGG - Intergenic
906934095 1:50196530-50196552 CATTTTCATCAAAGGGAAGCTGG - Intronic
908833699 1:68207745-68207767 CACTTTTACAAAAGGGAAACTGG - Intronic
909512087 1:76464774-76464796 CACTTTATAGACAGAGAAGCTGG + Intronic
910605407 1:89078228-89078250 GTCTTTATCCAAAGGAAAGAAGG + Intergenic
911022347 1:93401371-93401393 GACTTTCTTCAAAGGGCAGCAGG - Intergenic
912152993 1:106882289-106882311 CACCTTCTCCACAGGGAAGCAGG + Intergenic
913153711 1:116072838-116072860 GACTTTCTCCATAGGGAAGAGGG - Intergenic
914941852 1:152030130-152030152 CACTGTGTCCAAAGGAATGCGGG + Intergenic
916782048 1:168044199-168044221 CCATTTATCCATAGGAAAGCTGG + Intronic
918613883 1:186522772-186522794 CACTTTTTCCACAAGGCAGCAGG - Intergenic
919920509 1:202164131-202164153 CCCTTCATCCAAAAGGTAGCAGG - Intergenic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
920944146 1:210512344-210512366 CACACTAGCCAAAGGGAAGCAGG - Intronic
921086425 1:211797832-211797854 CACTATTTCCAAAGGGAAAAAGG + Intronic
921705531 1:218318709-218318731 CACTTTAACCAAGTGGAAACTGG - Intronic
923742375 1:236667268-236667290 CAATTGATCCAAAAGAAAGCAGG - Intergenic
923893175 1:238238216-238238238 CAATTAATCCAAAGGAAGGCAGG + Intergenic
924126199 1:240854658-240854680 CCTTTTATCCAAAGCAAAGCAGG + Intronic
924319417 1:242832757-242832779 GACTTTATCCAAAGGACAGTTGG + Intergenic
1067769967 10:49115807-49115829 CACTTATTCCTAAGGGAAGGCGG + Intergenic
1068083005 10:52343088-52343110 AACTCTATTCAAATGGAAGCAGG - Intergenic
1069435133 10:68374339-68374361 CACTTTAATCAACGGAAAGCAGG + Intronic
1069578964 10:69552187-69552209 GAGTTTATTCTAAGGGAAGCTGG + Intergenic
1069612959 10:69787568-69787590 CACTTCATCCACAGGGCACCTGG - Intergenic
1069841302 10:71341090-71341112 CACTTTAACCAATGAGAGGCAGG - Intronic
1071260595 10:83915779-83915801 GACATTATCCAAAGGGAAAGTGG + Intergenic
1073447923 10:103592166-103592188 CATTTTATAGAAATGGAAGCTGG - Exonic
1073585573 10:104706670-104706692 AAATTTATCCACAGGGAAGTGGG - Intronic
1077972650 11:7211237-7211259 CATTTTACCCAAAGGGCAGAGGG - Intergenic
1079138523 11:17792098-17792120 CACTCTATCAAGAGGGTAGCTGG + Intronic
1080347308 11:31339326-31339348 CACATTATCAATAAGGAAGCAGG + Intronic
1082776958 11:57252927-57252949 GACAACATCCAAAGGGAAGCAGG + Intergenic
1083150523 11:60789119-60789141 CACATTTTCCACAGGGATGCAGG - Intronic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1087803880 11:102534557-102534579 GACTTTATCCCAAGGGCATCAGG + Intergenic
1089114709 11:116085255-116085277 CACTTCCTCCAATGTGAAGCTGG - Intergenic
1092373686 12:7937789-7937811 TACTTTATAAAAAGGGAAGAAGG - Intergenic
1092695661 12:11168858-11168880 CACTTTATCCAAAGGAAAAATGG + Intronic
1094036830 12:26081104-26081126 CACTTTCTTCACAAGGAAGCAGG + Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1099670746 12:85688884-85688906 CCCATTATCCAAAGGGATGAGGG - Intergenic
1101494564 12:105241443-105241465 CACTGTACCCAAAGAGAAGAAGG + Intronic
1101705645 12:107218298-107218320 CACCTTATCCAATGGAAAGGTGG + Intergenic
1106744554 13:32686149-32686171 CACTGTAATCAAAAGGAAGCTGG - Intronic
1107135186 13:36936836-36936858 AACTTTAATCAAAGGAAAGCAGG - Intergenic
1109133828 13:58623178-58623200 CACCTTCTCCAAAAGGCAGCAGG + Intergenic
1112604170 13:100887890-100887912 CACTTTGTCCCAAGGGAATCTGG - Intergenic
1115980706 14:39048643-39048665 CCCTTTATCCACAGGTAAGTAGG - Exonic
1123912205 15:24978833-24978855 CACATTATCTGAAGGGAAGTGGG + Intergenic
1124085896 15:26550139-26550161 AACTTTCTCCAACAGGAAGCAGG + Intronic
1127323454 15:57869700-57869722 AACTTTAATCAAAGGGAAACGGG + Intergenic
1127491856 15:59472521-59472543 CACATAATCAACAGGGAAGCTGG - Intronic
1129766074 15:78168672-78168694 CTCTTGATGCAAAGGGAGGCAGG - Exonic
1129781552 15:78275303-78275325 CACATTATGCCAAGGGAAGCGGG + Intronic
1131260169 15:90883989-90884011 AATTTTATTCAAATGGAAGCTGG + Intronic
1131792966 15:95984679-95984701 TTCATTCTCCAAAGGGAAGCTGG - Intergenic
1133118428 16:3591429-3591451 CACCGTCTTCAAAGGGAAGCAGG - Intronic
1133237816 16:4395876-4395898 CAGATTATCCAAAGGGAGGATGG + Intronic
1134685685 16:16156575-16156597 CACTTTACCCCAAGGGAAGCTGG + Intronic
1135056308 16:19234696-19234718 CACTTTACACAAAAGTAAGCTGG - Intronic
1135300952 16:21326710-21326732 ACCTTTATCCAAAGGGAAGAGGG - Intergenic
1135657553 16:24264296-24264318 GACTCTATCCAAAGGGAGGAGGG + Intronic
1137546514 16:49408191-49408213 CAGCCTATCCAAGGGGAAGCCGG + Intergenic
1141593027 16:85081270-85081292 CACTCTCTCCAAGGGGAGGCGGG - Intronic
1143467345 17:7146346-7146368 GAATTTATCCAAAGGAAAGAAGG + Intergenic
1143690774 17:8563186-8563208 CACTTAATCCAAAGGCCAGATGG + Intronic
1143908977 17:10231904-10231926 CAGTACATCCAAAGTGAAGCTGG - Intergenic
1146929334 17:36766695-36766717 TTCTCTATGCAAAGGGAAGCTGG + Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1157374289 18:47149465-47149487 GACTTTATCCAGAGGTCAGCGGG - Intronic
1159823538 18:73176845-73176867 CACTTTAAACAAAAGGAAACTGG - Intronic
1160244281 18:77144760-77144782 CACTAAATGCAAAGTGAAGCTGG - Intergenic
1162750275 19:12825495-12825517 GACTTTATTCAAAGGGGAGAGGG + Exonic
1164189854 19:22904109-22904131 CACGTAGGCCAAAGGGAAGCTGG + Intergenic
1166789925 19:45392615-45392637 CACATTACCGAAAGGGAATCTGG + Intronic
1168434932 19:56309495-56309517 AACTTTATTAAAAGGGATGCAGG + Intronic
1168521524 19:57054731-57054753 AACTTTTTCCAGAGGGCAGCAGG - Intergenic
925401906 2:3580393-3580415 CACATAATCCAAAGGAGAGCAGG - Intronic
925924946 2:8663516-8663538 CACCTTCTCCACAGGGCAGCAGG + Intergenic
926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926894876 2:17674831-17674853 AACATTAGCCAAAGGGAAGCTGG - Intronic
927827471 2:26318700-26318722 GACTTTATCCAAAGTACAGCAGG + Intronic
928040002 2:27865491-27865513 CAGTTAATCCAAAAGAAAGCAGG - Intronic
928661823 2:33509453-33509475 TCCTTTATCCAAAGGGCAACGGG - Intronic
930899497 2:56486359-56486381 CACTTGAGCCAAATGTAAGCAGG - Intergenic
932344439 2:70986361-70986383 GACTTTATCCTGAGGGCAGCAGG + Exonic
936831306 2:116651698-116651720 CACTTTAATGAAAGAGAAGCAGG + Intergenic
937124247 2:119463220-119463242 CACTTAATCGCAAAGGAAGCAGG - Intronic
941972774 2:171370084-171370106 CAATTTATCCAAAAGCAGGCAGG + Intronic
943107788 2:183568320-183568342 CATTTTCTCTTAAGGGAAGCTGG + Intergenic
943440908 2:187926851-187926873 CAAGTTATTCAAAGAGAAGCTGG - Intergenic
945791444 2:214310537-214310559 CTCAATATCCAAAGGGAAACTGG - Intronic
946348044 2:219127086-219127108 GACTTTATCCTAAGGACAGCAGG + Intronic
947369300 2:229428202-229428224 CCCATTCTCCAAAGGGTAGCTGG - Intronic
947449043 2:230188683-230188705 ATCTTTATCTAAAGGGATGCTGG + Intronic
1169497402 20:6128560-6128582 CACTTTATTCAAACCAAAGCTGG + Intergenic
1169851830 20:10060738-10060760 AACTTGATCCATAGGCAAGCAGG - Intergenic
1170408328 20:16063003-16063025 CAATTAACACAAAGGGAAGCCGG + Intergenic
1172942945 20:38666838-38666860 CAGTTTGTCCAAGGGGATGCTGG + Intergenic
1173533966 20:43794670-43794692 CACATTATCCAAAGCCAAGGGGG - Intergenic
1173540734 20:43848919-43848941 CACTTTCTCCAAAGAAATGCTGG - Intergenic
1174126405 20:48310129-48310151 CATTTTCTCCAAAGGGAAAATGG - Intergenic
1174279343 20:49427558-49427580 GACTTTATCCTAAGGGTAACAGG + Intronic
1175417770 20:58812890-58812912 CACTTTCTCAAAAGGCAAGACGG - Intergenic
1178047673 21:28713381-28713403 CACTTTATCCTAAGTGCAGTGGG - Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1181528738 22:23504074-23504096 GACTTTATCCAGAGGGCAGCAGG - Intergenic
1184564067 22:45281086-45281108 CACTTTATCCACATGCAAGCTGG + Intergenic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
951129762 3:19028634-19028656 CACTTAATGCAAATGAAAGCTGG + Intergenic
951140735 3:19155536-19155558 GACATTATCCAAAAGGCAGCAGG - Intronic
951532564 3:23711516-23711538 CTCTTTATCCACAGAGAAGCTGG + Intergenic
951890111 3:27560486-27560508 CACTTTGGCCAACTGGAAGCGGG + Intergenic
953340879 3:42133177-42133199 CATTTTATCCAAAGGGCAATGGG - Intronic
954134648 3:48576399-48576421 GACTGGATCCAAAGGGGAGCAGG - Exonic
954369821 3:50164250-50164272 CACTTAGTGCCAAGGGAAGCTGG - Intronic
955326857 3:58015187-58015209 CATTTTATAGACAGGGAAGCAGG - Intronic
955335757 3:58084397-58084419 CACATTAACAACAGGGAAGCCGG - Intronic
955590815 3:60533342-60533364 CACTGAATCTAAAGTGAAGCTGG - Intronic
958572598 3:95906993-95907015 TACTGTATCCACAGGGAAGTTGG - Intergenic
959919378 3:111854107-111854129 CACTTTCTTCACAGGGCAGCAGG + Intronic
960424716 3:117492419-117492441 CACCTTCTCCACAGGGCAGCTGG - Intergenic
962673038 3:137728413-137728435 CAATTAATCAAAAGGGAAACAGG - Intergenic
963557882 3:146817934-146817956 CACTTTAAGCAAAGTGAAGCTGG + Intergenic
964004734 3:151813333-151813355 CGCTTTATGCATAGGGATGCTGG - Intergenic
964668522 3:159200279-159200301 CACTTTGTCAACAGGGAAACAGG - Intronic
965631802 3:170740817-170740839 CACTATATACAAAGGAAAGAAGG + Intronic
966198393 3:177336371-177336393 CACTTTGTCAAATGGAAAGCCGG + Intergenic
966225543 3:177593533-177593555 CATTTTATCCACACGGAAACTGG - Intergenic
970990204 4:22204261-22204283 CAGGTTTTCCCAAGGGAAGCAGG + Intergenic
971832453 4:31713771-31713793 CACTTTATCAAAAGTTATGCTGG + Intergenic
972848050 4:43013674-43013696 CAGTTTATGCAAAGAGAATCTGG + Intronic
973839732 4:54849065-54849087 CTATTTATCCAAAGGAGAGCAGG - Intergenic
974101624 4:57423333-57423355 CACCTTCTTCACAGGGAAGCAGG - Intergenic
975390794 4:73815016-73815038 GTCTTTTTCCAATGGGAAGCAGG - Intergenic
976672295 4:87666750-87666772 CACATTATTCAAAGGAAAGGTGG + Intergenic
977513136 4:97987122-97987144 CACTTCATTAAAAGGCAAGCTGG + Intronic
977799439 4:101208464-101208486 CACTAAATACAAAGGGATGCTGG + Intronic
979856854 4:125644291-125644313 AACTTTAGACAAAGAGAAGCTGG + Intergenic
980854353 4:138421532-138421554 GACTTTATGCAGAGGGAAGTGGG + Intergenic
982333215 4:154205520-154205542 GGCTTTATCCCAAGTGAAGCAGG - Intergenic
983921356 4:173349156-173349178 GACTTTCTCCAAAGGTAAGTAGG + Intergenic
984426185 4:179589407-179589429 CACTTAACCCACAGGAAAGCAGG - Intergenic
986506098 5:8453331-8453353 TATTTTATGGAAAGGGAAGCAGG - Intergenic
988860734 5:35275500-35275522 CACTCCATCCAAAGGGAAGCAGG - Intergenic
989297098 5:39841536-39841558 CACATTATCCAAAGGCCAGGTGG - Intergenic
989989797 5:50748114-50748136 CATTTAATCCAAAAGAAAGCAGG - Intronic
992467193 5:77018310-77018332 CACTTCATCCCCAGTGAAGCTGG - Intergenic
993869143 5:93230307-93230329 AACATTAACCAAAGGAAAGCAGG + Intergenic
994799218 5:104349730-104349752 CACTTTATGCAAAGGCAAATTGG + Intergenic
995833303 5:116376971-116376993 CACTTTAGGCAAAGGAAATCTGG - Intronic
996289608 5:121836271-121836293 CACTTTATACAGAGGGAAAAAGG + Intergenic
998105927 5:139469274-139469296 GACTTTAGCCAGAGGGAATCTGG - Intergenic
999576923 5:152989026-152989048 CACTTTATTCAAAGGACAGAAGG + Intergenic
1003225973 6:4205852-4205874 CACATTATCTCAAGTGAAGCAGG - Intergenic
1003911788 6:10749917-10749939 CTCTTTATCTAAAGGTAGGCAGG + Intronic
1004242465 6:13937392-13937414 AACTTTATACAAATGGAATCAGG + Intronic
1005650833 6:27883391-27883413 AAGTTTATTCAAAGGAAAGCTGG + Intergenic
1007941474 6:45785497-45785519 CTCTTTCTCAAAAGGGATGCAGG - Intergenic
1008688838 6:53954871-53954893 CACTTTATAGAAATGGAATCAGG + Intronic
1008709152 6:54202602-54202624 CACTGTATCCAGCTGGAAGCAGG - Intronic
1009502333 6:64430713-64430735 CACTTCATGACAAGGGAAGCTGG - Intronic
1010580069 6:77585461-77585483 CATTTAATCCAAAGGGAATCTGG + Intergenic
1010832463 6:80547492-80547514 CACCTTCTTCACAGGGAAGCAGG - Intergenic
1011988145 6:93475979-93476001 CCATTTATCAAAAGGGAAGAAGG + Intergenic
1014309480 6:119782270-119782292 CACCTTCTCCACAGGGCAGCAGG + Intergenic
1014756669 6:125309280-125309302 CACCTTGTCCAAAGGCAAGGAGG + Intergenic
1014887390 6:126798105-126798127 CACTGTTTCGAAAGGGAAGGTGG + Intergenic
1015241740 6:131031926-131031948 CACTTACTCCAAAGTGAAGAGGG + Intronic
1017565383 6:155679377-155679399 CATTTTATACAAGGGGAAACTGG + Intergenic
1019734797 7:2645322-2645344 CATTTCATCCACAGGGAAACTGG - Intronic
1020616014 7:10463630-10463652 CACTTTATCCTAAAGGCAACTGG - Intergenic
1022592054 7:31672979-31673001 CACTTTGTTCACAGGGAAGCAGG - Intergenic
1023247706 7:38223314-38223336 CATTTAATACAAAGGGATGCAGG - Intronic
1024773061 7:52747872-52747894 TAGTTTATACAAAAGGAAGCAGG + Intergenic
1025030307 7:55551592-55551614 CCCTTTTTCCTAAGGGAAGGGGG - Intronic
1027921090 7:84395716-84395738 CACCTTCTTCAAAGGGCAGCAGG - Intronic
1029161112 7:98552700-98552722 CTCTCTTTCCAAAGGGAGGCTGG + Intergenic
1030939816 7:115632073-115632095 CACATTAACCAATGGGGAGCAGG - Intergenic
1032541284 7:132705169-132705191 CACCTTCTTCAAAGGGAATCAGG - Intronic
1037553366 8:19996904-19996926 CACTTTTCCCAAAGGCAAGATGG + Intergenic
1037973932 8:23196110-23196132 CACTACATCCAATGGGATGCTGG + Intronic
1039046159 8:33451822-33451844 CACTTTCTTCACAGGGCAGCAGG + Intronic
1041430548 8:57776836-57776858 CACTTTCTTCACAGGGCAGCAGG - Intergenic
1041901284 8:62985831-62985853 AACTTTATTTAAAAGGAAGCAGG + Intronic
1045056255 8:98370705-98370727 AACCTTATGCAAAGGGAAGCTGG - Intergenic
1048012017 8:130465494-130465516 GCCTTTATCCAAAAGAAAGCTGG - Intergenic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1048884836 8:138901753-138901775 GACTTTATCCAAAGGCAATGAGG - Intronic
1050809398 9:9725008-9725030 CACATTATCAAGAGGGAAACAGG + Intronic
1051364778 9:16313893-16313915 CACTTTAAGGAAATGGAAGCTGG - Intergenic
1052544815 9:29863303-29863325 TGCTCTATCAAAAGGGAAGCTGG + Intergenic
1052679180 9:31667225-31667247 CACTTTATAGAAATGGAATCAGG - Intergenic
1055189384 9:73498751-73498773 CACTTTCTTCACAGGGCAGCAGG - Intergenic
1055839409 9:80484179-80484201 CAATTTATCATAAGGGAAGAAGG - Intergenic
1056563712 9:87755643-87755665 CACTTTTTCCCAAGGGTGGCCGG - Intergenic
1056835601 9:89952926-89952948 CACTCAACCCCAAGGGAAGCTGG + Intergenic
1059420344 9:114186688-114186710 GACTTTATCCAAAGAGCAGCTGG + Intronic
1059655603 9:116354849-116354871 GACTTTATCCTAAGGGACGGGGG - Intronic
1061255376 9:129452078-129452100 GACTTTATCCAGAGGGCAGCGGG + Intergenic
1062021364 9:134320931-134320953 GACTTTATCCCAAGGGCAGTGGG + Intronic
1062660483 9:137629010-137629032 TACTTTATCCTAAGGTAAGTGGG + Intronic
1187000163 X:15168338-15168360 CACCTTGTCCTAAGGGAAGATGG + Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190688460 X:52894468-52894490 GACTTTATCCTAAGGGCAGCAGG + Intronic
1190697523 X:52961324-52961346 GACTTTATCCTAAGGGCAGCAGG - Intronic
1192451725 X:71249031-71249053 CACTTCTTACAAAGTGAAGCAGG - Exonic
1195324266 X:103745370-103745392 CAGTTTATCCAAAGGGGCTCAGG - Intergenic
1198160498 X:134003221-134003243 TACTTTACCCAAAGGAATGCTGG - Intergenic
1199338871 X:146651868-146651890 CACTTTCTTCACAGGGCAGCAGG + Intergenic