ID: 1048239709

View in Genome Browser
Species Human (GRCh38)
Location 8:132729453-132729475
Sequence CAAGTCAATGAGCTCTAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 107}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048239709_1048239712 20 Left 1048239709 8:132729453-132729475 CCAGTTTAGAGCTCATTGACTTG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1048239712 8:132729496-132729518 GAGTAGCCAGAGTCCTGCTTTGG No data
1048239709_1048239715 28 Left 1048239709 8:132729453-132729475 CCAGTTTAGAGCTCATTGACTTG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1048239715 8:132729504-132729526 AGAGTCCTGCTTTGGGATGTAGG No data
1048239709_1048239713 21 Left 1048239709 8:132729453-132729475 CCAGTTTAGAGCTCATTGACTTG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1048239713 8:132729497-132729519 AGTAGCCAGAGTCCTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048239709 Original CRISPR CAAGTCAATGAGCTCTAAAC TGG (reversed) Intronic
900012021 1:121921-121943 CAAGTCAATTAGCTTTGTACTGG - Intergenic
900042081 1:477934-477956 CAAGTCAATTAGCTTTGTACTGG - Intergenic
900063519 1:712880-712902 CAAGTCAATTAGCTTTGTACTGG - Intergenic
902238617 1:15073839-15073861 CCAGACCATGAGCCCTAAACTGG + Intronic
902534718 1:17112872-17112894 AGGGTCAATGAGCTCTAACCAGG - Intronic
903413666 1:23167727-23167749 CACCTCCAAGAGCTCTAAACCGG + Intronic
905996402 1:42384941-42384963 CAAGTCACTTATCTCTAAAAAGG + Intronic
910633581 1:89382736-89382758 AAACTCAATGAGCTCTCAAAGGG + Exonic
912706408 1:111918256-111918278 AAAGACAATGAGATCTAAAAAGG + Intronic
920730447 1:208478582-208478604 CAAATAAAAGAGCTCTAAGCTGG + Intergenic
921430316 1:215057914-215057936 CTATTCACTGAGCACTAAACTGG - Intronic
922260448 1:223938403-223938425 CAAGTCAATTAGCTTTGTACTGG - Intergenic
922320784 1:224484460-224484482 ATAGTCAATGTGCTCAAAACTGG - Intronic
922733225 1:227964528-227964550 CAAGTCAATTAGCTTTGTACTGG + Intergenic
924341623 1:243040593-243040615 CAAGTCAATTAGCTTTGTACTGG - Intergenic
1064021929 10:11815915-11815937 CAAGTGACTGAGATCCAAACAGG - Intergenic
1064471835 10:15643321-15643343 CGAGCCACTGAGCTCTAACCTGG - Intronic
1064998066 10:21313851-21313873 CAAGCCAATGAGCTCAACACAGG + Intergenic
1066482142 10:35807151-35807173 GAAGACAATGAGCTATAGACAGG + Intergenic
1066734854 10:38464958-38464980 CAAGTCAATTAGCTTTGTACTGG + Intergenic
1072179074 10:92962431-92962453 CAAGTCACTGCACTCTAACCTGG - Intronic
1072813983 10:98486730-98486752 AAAGTCAATGTGCTTGAAACTGG + Intronic
1075631226 10:124001724-124001746 CATGTCACTGAGCTCTACCCGGG - Intergenic
1076968352 11:114141-114163 CAAGTCAATTAGCTTTGTACTGG - Intergenic
1078930149 11:15906293-15906315 CCAGGCACTGAGCTCTGAACGGG + Intergenic
1081101231 11:39005681-39005703 CCAGTCAATGGGATCTAAAATGG - Intergenic
1086294425 11:85348934-85348956 CAACTCAATGATTTTTAAACAGG - Intronic
1088627562 11:111741525-111741547 CTAGTCAATGTGTTCTTAACTGG - Intronic
1088911244 11:114194041-114194063 GAACTCAATGACCTCTAAACAGG - Intronic
1096182173 12:49557086-49557108 CAGGTCAATGTGCTCTAACTGGG + Intronic
1096964899 12:55618252-55618274 CAAGGAAATAAGCTCTAAACAGG + Intergenic
1097289005 12:57898177-57898199 GAAGACAATGGGCTCTTAACTGG + Intergenic
1098919450 12:76290413-76290435 CTAGACTATGAGCTCTAAAAAGG + Intergenic
1106277562 13:28227344-28227366 CAATTCAATGAGATTTAAACAGG - Intronic
1111142449 13:84137399-84137421 CCAATCAATCAGCTGTAAACAGG - Intergenic
1118979539 14:70705266-70705288 CACTTCAATATGCTCTAAACTGG + Intergenic
1120077480 14:80175405-80175427 AAATTCAATGAGCTATAAATAGG + Intergenic
1124367264 15:29080991-29081013 CAAGTTGATGAGCTATAGACAGG - Intronic
1124558244 15:30747392-30747414 CCAGTGAATGAACTCTCAACAGG - Intronic
1126463595 15:48939525-48939547 CAATTCAATGAGCTCTTAGAGGG + Intronic
1130938987 15:88492222-88492244 CAAGTCAATGAGCTCAGCACAGG - Intergenic
1133197317 16:4180373-4180395 TAAGTCAAGGAGCTCAAAAAGGG - Intergenic
1137695527 16:50459588-50459610 AAAGTCAATGGTGTCTAAACAGG + Intergenic
1138271362 16:55698226-55698248 CAAGTCAATAAGCAATTAACAGG - Intronic
1138776203 16:59726971-59726993 CAAGTCACTGAGCCCTTTACAGG + Intronic
1141813486 16:86392671-86392693 GAAGTCAAGGAGCTCTAGACTGG + Intergenic
1142452326 16:90184993-90185015 CAAGTCAATTAGCTTTGTACTGG + Intergenic
1146947802 17:36885698-36885720 CAAGTCCATGAAATGTAAACTGG - Intergenic
1149515270 17:57276420-57276442 CAAGCAACTGAGGTCTAAACTGG - Intronic
1151925920 17:77196430-77196452 AAATTCAATGACTTCTAAACTGG - Intronic
1152472328 17:80496901-80496923 CGATTCAATGAGCTCTGGACAGG - Intergenic
1156456032 18:37294814-37294836 CAAGTCAAGGAGATCAAATCTGG - Intronic
1157482367 18:48063519-48063541 GAAGTTAATGAGATTTAAACAGG + Intronic
1160435020 18:78844585-78844607 AAACTCAATGAGCTCTAATTAGG - Intergenic
1160645160 19:184075-184097 CAAGTCAATTAGCTTTGTACTGG - Intergenic
1163601921 19:18254503-18254525 CAAGTCAACCAGTTCTAATCTGG + Intronic
1165246279 19:34500252-34500274 CACGTCACTGAGCTCTGAGCAGG + Exonic
931516521 2:63053354-63053376 CAAGTAAATGAGCTCTGCGCTGG - Intronic
934784250 2:96993250-96993272 CAAGTAAAAGATCTCAAAACTGG - Intronic
935677295 2:105606461-105606483 CAAATCAGTAAGCTATAAACAGG + Intergenic
936408364 2:112229475-112229497 TAAGTAAATGTGCTGTAAACAGG + Intronic
936764305 2:115827237-115827259 CAAGGTAATAAGCTGTAAACAGG + Intronic
937508613 2:122567244-122567266 CAAATCAATGAGCTGGAAAAAGG - Intergenic
945036394 2:205707472-205707494 CAAGTAAATGAACTCTAAAAGGG + Intronic
946073661 2:217055575-217055597 CGAGTCCAGGAGCTCTGAACAGG - Intergenic
946673852 2:222136085-222136107 GAAGTCAATGATTTCTAATCTGG + Intergenic
947094133 2:226546529-226546551 CAAGTCTGTGAACTCTAAAATGG + Intergenic
949083768 2:242129636-242129658 CAAGTCAATTAGCTTTGTACTGG + Intergenic
1168902810 20:1379518-1379540 TAAGTAAAGGAGCTTTAAACAGG + Intronic
1170856011 20:20055814-20055836 CTAGCCAGTGAGCTCAAAACAGG - Intronic
1173528707 20:43752145-43752167 CAAGTCCTTGAGGTCTAATCTGG + Intergenic
1174461523 20:50686355-50686377 CAAGACAACGGGCTCTTAACAGG + Intronic
1176280353 20:64302167-64302189 CAAGTCAATTAGCTTTGTACTGG + Intergenic
1176976689 21:15328673-15328695 CAAGTTAATCAGCTTTAAAGTGG - Intergenic
1177558747 21:22723576-22723598 AAAGTCAATGCACTCTAACCTGG - Intergenic
949228530 3:1722914-1722936 CAAATCAATGAGCTATTAAGTGG + Intergenic
949654654 3:6203809-6203831 CAAGTCAATGAAAGCTAAGCAGG + Intergenic
950825794 3:15819232-15819254 CATGTCACTGCACTCTAAACTGG + Intronic
956075069 3:65496349-65496371 GAAGTCAAAGAGCTTTAAAAAGG - Intronic
961772624 3:129261043-129261065 CAAATCAATGAACCCTTAACTGG - Intronic
963343204 3:144062565-144062587 GAAGTCATTGAGTTTTAAACAGG - Intergenic
963645431 3:147907889-147907911 CAAAACATTAAGCTCTAAACTGG - Intergenic
968238592 3:197054235-197054257 AAAGTCAATGAACTCAAAGCAGG - Intronic
968286860 3:197513749-197513771 CAAGTCAATGACTTCTAAAGTGG + Intronic
968372522 3:198235453-198235475 CAAGTCAATTAGCTTTGTACTGG + Intergenic
969281751 4:6175277-6175299 CAAGTAAGTGAGCTCCAAATGGG + Intronic
970042985 4:11817706-11817728 ACAGTCAATCAGCTCCAAACCGG + Intergenic
972691777 4:41405969-41405991 CAAGTCAAGGCAATCTAAACAGG - Intronic
975599399 4:76083738-76083760 CAAGTCAATGACCTGTAATCAGG - Intronic
976587603 4:86816249-86816271 CAAGTCAACTAGCTCAGAACTGG - Intergenic
979261208 4:118647920-118647942 CAAGTCAATTAGCTTTGTACTGG + Intergenic
996198807 5:120644061-120644083 CAAGTCATTGAGCTCTATCCAGG - Intronic
997611595 5:135219398-135219420 CAAGTCTTTTAGGTCTAAACGGG + Intronic
1001593486 5:172882447-172882469 CCAAAAAATGAGCTCTAAACTGG + Intronic
1002731762 5:181340995-181341017 CAAGTCAATTAGCTTTGTACTGG + Intergenic
1002752767 6:133082-133104 CAAGTCAATTAGCTTTGTACTGG - Intergenic
1002757468 6:175749-175771 CAAGACAATGTGATCCAAACAGG - Intergenic
1004767632 6:18748471-18748493 GAAGGCACTGAGCTCTACACTGG + Intergenic
1005212183 6:23479354-23479376 CCAGTCAATGATCTTTAAAAGGG + Intergenic
1009731141 6:67608694-67608716 CCAGTCAAAGAGCTAAAAACTGG + Intergenic
1011959670 6:93071595-93071617 CATGTCAATGTGCACTAAAGAGG + Intergenic
1016090905 6:139977753-139977775 CCAGCAAATGAGCTCTCAACTGG - Intergenic
1016562084 6:145407932-145407954 TATGTCAATGACCTTTAAACTGG - Intergenic
1019236015 6:170613308-170613330 CAAGTCAATTAGCTTTGTACTGG + Intergenic
1035511753 8:193264-193286 CAAGTCAATTAGCTTTGTACTGG - Intronic
1038486453 8:27938523-27938545 CAAGTCATTTATCTCTAAACAGG - Intronic
1042162480 8:65911524-65911546 CATGTCAATGAGATCTAACTTGG - Intergenic
1048239709 8:132729453-132729475 CAAGTCAATGAGCTCTAAACTGG - Intronic
1048430306 8:134364411-134364433 CAAGGCAATCAGCCCTAAATGGG + Intergenic
1055775646 9:79764480-79764502 CAAGGCAGTGAGCTCTGATCTGG + Intergenic
1062756168 9:138293507-138293529 CAAGTCAATTAGCTTTGTACTGG + Intergenic
1185884810 X:3773017-3773039 CAAGGCAATTATCTCTAAAGGGG + Intergenic
1186909645 X:14149009-14149031 CAAATCAATGTGCTCTAGATAGG - Intergenic
1191726794 X:64290275-64290297 CAGGACAAAGAGCACTAAACTGG + Intronic
1191885230 X:65881298-65881320 CAAGTCTATGAAATCTGAACAGG - Intergenic
1193239592 X:79151808-79151830 CAAGTAAATAAGCTCTAAGAGGG - Intergenic
1197729606 X:129798502-129798524 CAAGGCACTGAGCTCAAGACTGG + Intergenic
1199321956 X:146450309-146450331 CATGTGAAGGAGCTCTAACCAGG - Intergenic
1200914153 Y:8556610-8556632 GAAGTCATTGAGCTGGAAACAGG - Intergenic