ID: 1048239712

View in Genome Browser
Species Human (GRCh38)
Location 8:132729496-132729518
Sequence GAGTAGCCAGAGTCCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048239709_1048239712 20 Left 1048239709 8:132729453-132729475 CCAGTTTAGAGCTCATTGACTTG 0: 1
1: 0
2: 0
3: 11
4: 107
Right 1048239712 8:132729496-132729518 GAGTAGCCAGAGTCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048239712 Original CRISPR GAGTAGCCAGAGTCCTGCTT TGG Intronic
No off target data available for this crispr