ID: 1048245489

View in Genome Browser
Species Human (GRCh38)
Location 8:132792718-132792740
Sequence ATTTATCTCCAGAAGTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048245484_1048245489 24 Left 1048245484 8:132792671-132792693 CCTGTCATGGTGCTAGGTCCTGG 0: 1
1: 1
2: 5
3: 66
4: 577
Right 1048245489 8:132792718-132792740 ATTTATCTCCAGAAGTTCACAGG No data
1048245488_1048245489 6 Left 1048245488 8:132792689-132792711 CCTGGGGACTACAAAAGTAAACA 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1048245489 8:132792718-132792740 ATTTATCTCCAGAAGTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048245489 Original CRISPR ATTTATCTCCAGAAGTTCAC AGG Intronic
No off target data available for this crispr