ID: 1048247047

View in Genome Browser
Species Human (GRCh38)
Location 8:132816960-132816982
Sequence ATCATCAGGCATGGGTAAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048247047_1048247051 -10 Left 1048247047 8:132816960-132816982 CCACCTTACCCATGCCTGATGAT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1048247051 8:132816973-132816995 GCCTGATGATTCTGTAGAAAAGG 0: 1
1: 1
2: 6
3: 39
4: 781
1048247047_1048247053 18 Left 1048247047 8:132816960-132816982 CCACCTTACCCATGCCTGATGAT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1048247053 8:132817001-132817023 TCTCCCTCTCCAGCCACTGATGG 0: 1
1: 0
2: 3
3: 44
4: 364
1048247047_1048247054 19 Left 1048247047 8:132816960-132816982 CCACCTTACCCATGCCTGATGAT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048247047 Original CRISPR ATCATCAGGCATGGGTAAGG TGG (reversed) Exonic