ID: 1048247049 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:132816968-132816990 |
| Sequence | TCTACAGAATCATCAGGCAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 137 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 124} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048247049_1048247053 | 10 | Left | 1048247049 | 8:132816968-132816990 | CCCATGCCTGATGATTCTGTAGA | 0: 1 1: 0 2: 0 3: 12 4: 124 |
||
| Right | 1048247053 | 8:132817001-132817023 | TCTCCCTCTCCAGCCACTGATGG | 0: 1 1: 0 2: 3 3: 44 4: 364 |
||||
| 1048247049_1048247054 | 11 | Left | 1048247049 | 8:132816968-132816990 | CCCATGCCTGATGATTCTGTAGA | 0: 1 1: 0 2: 0 3: 12 4: 124 |
||
| Right | 1048247054 | 8:132817002-132817024 | CTCCCTCTCCAGCCACTGATGGG | 0: 1 1: 0 2: 2 3: 24 4: 303 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048247049 | Original CRISPR | TCTACAGAATCATCAGGCAT GGG (reversed) | Exonic | ||