ID: 1048247049

View in Genome Browser
Species Human (GRCh38)
Location 8:132816968-132816990
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048247049_1048247054 11 Left 1048247049 8:132816968-132816990 CCCATGCCTGATGATTCTGTAGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303
1048247049_1048247053 10 Left 1048247049 8:132816968-132816990 CCCATGCCTGATGATTCTGTAGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1048247053 8:132817001-132817023 TCTCCCTCTCCAGCCACTGATGG 0: 1
1: 0
2: 3
3: 44
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048247049 Original CRISPR TCTACAGAATCATCAGGCAT GGG (reversed) Exonic