ID: 1048247051

View in Genome Browser
Species Human (GRCh38)
Location 8:132816973-132816995
Sequence GCCTGATGATTCTGTAGAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 1, 2: 6, 3: 39, 4: 781}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048247047_1048247051 -10 Left 1048247047 8:132816960-132816982 CCACCTTACCCATGCCTGATGAT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1048247051 8:132816973-132816995 GCCTGATGATTCTGTAGAAAAGG 0: 1
1: 1
2: 6
3: 39
4: 781

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048247051 Original CRISPR GCCTGATGATTCTGTAGAAA AGG Exonic