ID: 1048247052

View in Genome Browser
Species Human (GRCh38)
Location 8:132816974-132816996
Sequence ACCTTTTCTACAGAATCATC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048247052_1048247053 4 Left 1048247052 8:132816974-132816996 CCTGATGATTCTGTAGAAAAGGT 0: 1
1: 0
2: 1
3: 28
4: 318
Right 1048247053 8:132817001-132817023 TCTCCCTCTCCAGCCACTGATGG 0: 1
1: 0
2: 3
3: 44
4: 364
1048247052_1048247054 5 Left 1048247052 8:132816974-132816996 CCTGATGATTCTGTAGAAAAGGT 0: 1
1: 0
2: 1
3: 28
4: 318
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048247052 Original CRISPR ACCTTTTCTACAGAATCATC AGG (reversed) Exonic