ID: 1048247054

View in Genome Browser
Species Human (GRCh38)
Location 8:132817002-132817024
Sequence CTCCCTCTCCAGCCACTGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 303}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048247048_1048247054 16 Left 1048247048 8:132816963-132816985 CCTTACCCATGCCTGATGATTCT 0: 1
1: 0
2: 0
3: 17
4: 143
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303
1048247049_1048247054 11 Left 1048247049 8:132816968-132816990 CCCATGCCTGATGATTCTGTAGA 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303
1048247050_1048247054 10 Left 1048247050 8:132816969-132816991 CCATGCCTGATGATTCTGTAGAA 0: 1
1: 0
2: 1
3: 26
4: 259
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303
1048247052_1048247054 5 Left 1048247052 8:132816974-132816996 CCTGATGATTCTGTAGAAAAGGT 0: 1
1: 0
2: 1
3: 28
4: 318
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303
1048247047_1048247054 19 Left 1048247047 8:132816960-132816982 CCACCTTACCCATGCCTGATGAT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1048247054 8:132817002-132817024 CTCCCTCTCCAGCCACTGATGGG 0: 1
1: 0
2: 2
3: 24
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048247054 Original CRISPR CTCCCTCTCCAGCCACTGAT GGG Exonic