ID: 1048248048

View in Genome Browser
Species Human (GRCh38)
Location 8:132830948-132830970
Sequence CTGGAGGCCGAGAGCTAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048248048 Original CRISPR CTGGAGGCCGAGAGCTAAGA CGG (reversed) Intronic
900368882 1:2322767-2322789 CGGGGGGCCGAGAGCTCAGTGGG + Intronic
901057270 1:6454425-6454447 CTGGCGGCCGTCAGCTAAGGCGG - Intronic
901364158 1:8731199-8731221 CTGGAGGTCCAGACTTAAGAGGG + Intronic
901449484 1:9327161-9327183 GTGGAGGCCGTGGGCTTAGAGGG - Intronic
902477095 1:16694066-16694088 CTGGCGGCCGTCAGCTAAGGCGG + Intergenic
906704250 1:47883134-47883156 ATGGAGGCAGAGAGCTGATAGGG - Intronic
908085718 1:60631610-60631632 CTAGAGACCGAGACCTCAGAAGG - Intergenic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
911187305 1:94916541-94916563 CTGGAGGAGGAGAGATTAGAGGG - Intronic
914894779 1:151659561-151659583 CTGGAGGCAGTGAGATAACAAGG - Intronic
915529224 1:156493875-156493897 CTGGGGGTGGGGAGCTAAGAAGG - Intronic
916426993 1:164690150-164690172 CTGGAGAGCGAGAGCACAGAGGG - Intronic
920461384 1:206143336-206143358 CTGGAGGCAGAGAGCTGGGCAGG + Intergenic
920672915 1:208018231-208018253 CTGGAGGCAGAGGGCACAGAAGG - Intergenic
920700613 1:208215663-208215685 ATGGAGGGAGAGAGCTAAGGAGG + Intronic
923543439 1:234906614-234906636 CTGGAGGTTCAGAGCTAAGTGGG - Intergenic
923783697 1:237048047-237048069 CTGGGGTCCGAGAGGCAAGAGGG - Intronic
1064323761 10:14330061-14330083 CAGCAGGCCGAGAGCTGAGTCGG + Exonic
1068773834 10:60850723-60850745 CAGGAGGCCTAGAACTAAGCTGG + Intergenic
1069447348 10:68485737-68485759 CAGGAGGCAAAGAGCTGAGATGG - Intronic
1070798806 10:79232987-79233009 CTGGAAGCCAGGAGCCAAGAGGG - Intronic
1070807251 10:79277789-79277811 CTGGAGGCCGACAGCACCGAGGG + Intronic
1073322544 10:102624293-102624315 CTGGAGATAGACAGCTAAGATGG - Intronic
1073583554 10:104688285-104688307 CTGGAGGCTGAAAGCTCTGAAGG + Intronic
1075317668 10:121465746-121465768 CTGGAGGGTGAGAGCTGAGCCGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076474038 10:130740075-130740097 CTGGAGGCCGAGAGCAGAGAGGG + Intergenic
1076481269 10:130786638-130786660 CTGCAGGCCGAGGGCTGGGAAGG + Intergenic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1078845143 11:15113715-15113737 CTGGGGGCCCAGGGCTCAGAAGG - Intronic
1082800818 11:57413724-57413746 CTGGAGAGAGAGAGGTAAGAAGG - Intronic
1082890210 11:58131113-58131135 CTGCAGGGCTAGAGCTCAGAAGG + Intronic
1083597822 11:63927591-63927613 CTGGAGGCTGTGAGCCCAGAGGG + Intergenic
1084087088 11:66859734-66859756 CTGGTGGCCGTGAGGTCAGAGGG - Exonic
1084988246 11:72897071-72897093 TGGGAGGCTGAGAGCTGAGATGG - Intronic
1089631803 11:119788732-119788754 CTGCAGGGCGAGAGCCAACATGG + Intergenic
1089685741 11:120145621-120145643 CAGGAGGCCCAGAGCTTACATGG + Intronic
1090691930 11:129192569-129192591 CTGGAGTCCGAGATCAAAAAAGG - Intronic
1091341167 11:134815163-134815185 CTGGAGTCAGAGAGATATGAGGG + Intergenic
1091584243 12:1806841-1806863 CTGGAGGCCTAGAGATAAGCAGG + Intronic
1091694924 12:2622066-2622088 CTGGAGGCCAAGAGCCAGGAAGG + Intronic
1095950992 12:47781881-47781903 CTGGAGGAGGAGAGCTGAGCTGG - Exonic
1097503204 12:60432333-60432355 CAGGAGGAAGAGAGCTAAGGGGG - Intergenic
1097588575 12:61545278-61545300 CAGGAGGCCGAGAGAGAAGGGGG + Intergenic
1097804765 12:63953105-63953127 CTGGAGTCAGAGATCTAAGTTGG - Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1102757948 12:115358592-115358614 CAGGAGGAAGAGAGCTAAGGTGG - Intergenic
1110794368 13:79619824-79619846 CAGGAGGAAGAGAGCAAAGAGGG - Intergenic
1111343753 13:86922854-86922876 CTGGAGCCTCAGAGCTTAGATGG - Intergenic
1118867703 14:69716363-69716385 CTGCAGGCCAAGAGCCTAGAAGG - Intergenic
1119776474 14:77252229-77252251 CTGGAGGCCAAGAGAGAGGATGG + Intronic
1120076751 14:80167737-80167759 CAGGAGGCCGAGACACAAGAGGG + Intergenic
1120681741 14:87488290-87488312 CTGGAGGCCGAGAGGAGTGAGGG - Intergenic
1121492307 14:94369282-94369304 CTGAAGGGCCAGAGCTAAAAGGG + Intergenic
1122769223 14:104090475-104090497 CTGGAGGCCGAGGCCTGAGAGGG + Intronic
1124013621 15:25859230-25859252 CTCGGGGCCGAGAGCTGAGGGGG - Intronic
1126493671 15:49266823-49266845 TTGGAGGTAGAGTGCTAAGAAGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1131121941 15:89828270-89828292 CTAGAGGCCGGGAACTCAGAAGG + Intergenic
1133873895 16:9714889-9714911 CTTGAGGCCATGAGGTAAGAAGG + Intergenic
1134589888 16:15443967-15443989 CTGCAGGCCAACAGCAAAGAGGG + Intronic
1140220164 16:73038026-73038048 CTAATGGCCGAGATCTAAGAAGG - Intronic
1142354161 16:89594261-89594283 CTGGAGGCCGAGAGCCAGGCTGG + Intronic
1142413029 16:89925856-89925878 CTCGAGGCCGGGAGCAAAGCCGG + Intronic
1144193828 17:12871518-12871540 CAGGAGGAAGAGAGCAAAGAGGG + Intronic
1147616998 17:41835744-41835766 CTTGGGGCAGAGAGCTAGGAGGG + Intronic
1147888196 17:43698621-43698643 TTGAAGGCCGAGAGCCAGGAAGG + Intergenic
1150233565 17:63573875-63573897 CTGGAGGCAGGGAGCCCAGAGGG - Intronic
1153067585 18:1063472-1063494 GTGGAGCCCAAGACCTAAGAAGG - Intergenic
1153415160 18:4838308-4838330 CTGGAGGCCCAGACTTGAGATGG - Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1158821060 18:61159273-61159295 CAGGAAGGTGAGAGCTAAGATGG - Intergenic
1158829333 18:61260373-61260395 CTGCAGGTGGAGAGCTGAGAGGG - Intergenic
1159748303 18:72268048-72268070 CTGGAGGACGAGAGAAAAGTAGG - Intergenic
1160568881 18:79803300-79803322 CTGGAGGCCTAGAGGTGAGGGGG - Intergenic
1161355148 19:3814883-3814905 CAGGAGGCCCAGAGCAAGGAGGG - Intronic
1161588910 19:5119831-5119853 CGGGAGGCCGAGGGCGCAGAAGG + Exonic
1162469689 19:10864998-10865020 CTGGAAGCAGAGACCTCAGAGGG - Intronic
1165299730 19:34961177-34961199 CTTCAGGCCCAGAGCTTAGAGGG - Intronic
1165860236 19:38905514-38905536 CTGGAGGCTGAAAACTACGAGGG + Exonic
1166991840 19:46697456-46697478 CTGGAGGAAGAGGGCTAAGTGGG - Intronic
1167478300 19:49713350-49713372 CTGGAGGCTGAGAAACAAGAGGG - Intronic
1168227384 19:55005552-55005574 GTGGAGGCCAAAAGATAAGATGG + Intergenic
1168340083 19:55617715-55617737 CTGGAGGACAAGTGCTAAGAGGG - Exonic
1202711111 1_KI270714v1_random:19892-19914 CTGGCGGCCGTCAGCTAAGGCGG + Intergenic
925296047 2:2778200-2778222 CTGGAGACCCAGCGCTGAGAAGG + Intergenic
925897485 2:8483820-8483842 CTGGAGACCAAGAGCAGAGATGG - Intergenic
927625103 2:24707871-24707893 CTGGAGGCCCAGAGCCAGGTGGG + Exonic
927708241 2:25310294-25310316 GGGGAGGCTGAGAGCTTAGAGGG - Intronic
929810471 2:45185256-45185278 CTGGAGGAAGACAGCTAAAATGG - Intergenic
933204296 2:79487621-79487643 CTGAAGGCTGAGAGCTCAGCTGG - Intronic
935705732 2:105855738-105855760 CTGGGTGCCGTTAGCTAAGAGGG + Intronic
936406742 2:112211408-112211430 CTGTAGGCAGAGTTCTAAGATGG - Intergenic
940215306 2:151297518-151297540 CTGGAGGCCGAGTCCATAGACGG + Intergenic
944531540 2:200672807-200672829 ATGGAGGCTGTGAGCTAAGCAGG + Intronic
945054083 2:205852749-205852771 CTGGAAGCCAACAGCAAAGAGGG + Intergenic
945130758 2:206569588-206569610 ATGGAGGCAGAGTCCTAAGAAGG + Intronic
946353334 2:219169572-219169594 CTGGAGGCCAGGAGCTGAGAAGG + Exonic
947598151 2:231426988-231427010 CTGGAGGCTGAGGGCTCAGCAGG - Intergenic
948262074 2:236612032-236612054 CTGGTCCCTGAGAGCTAAGATGG - Intergenic
948313053 2:237004115-237004137 CTGGAGGAAGAGAGCAAAGGGGG - Intergenic
948747511 2:240107171-240107193 CAGGAGGACGTGGGCTAAGAGGG + Intergenic
1168923069 20:1557306-1557328 CTGGAGGGTGAGAGCTGTGATGG + Intronic
1169494892 20:6105741-6105763 CTGTAGGCCAAGAACTAAGCTGG - Intronic
1170418428 20:16168912-16168934 AAGGAGGCCGAGAGCTATCAAGG + Intergenic
1172566727 20:35936356-35936378 CTGGAGTGGGAGAGCTGAGACGG + Intronic
1173730480 20:45325127-45325149 GTGGGGGCAGAGAGGTAAGAAGG - Intergenic
1175344970 20:58266284-58266306 CTGGAGCTCAAGAGCTAACACGG + Intergenic
1175780382 20:61678713-61678735 CTGGAGCCCCAGAGCTGAGTGGG - Intronic
1175955332 20:62606078-62606100 CTGGAGGCCTTGAGTTACGAGGG - Intergenic
1175965841 20:62659864-62659886 CTGGATGCCCAGAGCTTGGATGG + Intronic
1176038635 20:63052594-63052616 CTGGAGTCCTGGAGCTCAGAGGG + Intergenic
1178062842 21:28871351-28871373 CAGGAGGAAGAGAGCGAAGAGGG + Intergenic
1178518561 21:33268130-33268152 CTGGTGGCAGAAAGCTATGAGGG - Intronic
1179354074 21:40642293-40642315 CTGGAGGCGGAGAGCACAGCAGG + Intronic
1179539686 21:42076126-42076148 CTGGAGGCGGTGCCCTAAGATGG + Exonic
1179767934 21:43587909-43587931 CCGGAGGACCAGAGCTAAAAGGG + Intronic
1183269380 22:36851114-36851136 ATGGAGGCCGAGAGTGAAGAAGG - Intergenic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
1184278201 22:43422382-43422404 CTGGAGGCCTACAGCTCACAGGG - Intronic
1185071266 22:48658051-48658073 CAGGAAGCCGAGAGCTGAGGGGG + Intronic
950638233 3:14331029-14331051 CCCGAGGCCCACAGCTAAGAGGG - Intergenic
950640254 3:14344047-14344069 CTGGAGGCCGGGAGCCCAGGGGG + Intergenic
952187220 3:30983026-30983048 CTGGAGATCTAGAGCTGAGAGGG + Intergenic
953410111 3:42686022-42686044 CAGGAGGCCGAGACGGAAGACGG - Exonic
955579171 3:60400449-60400471 CTGGAGGTATAGAGATAAGAGGG - Intronic
960322938 3:116259836-116259858 ATAAAGGCAGAGAGCTAAGAAGG - Intronic
960950554 3:122996128-122996150 CTGGAGGGCGAAGCCTAAGAGGG + Intronic
961724708 3:128919832-128919854 CTGGAGGCCTAGAGGTACCAGGG - Intronic
962637443 3:137345592-137345614 CTGGAGGCTGAGAGAGGAGAAGG + Intergenic
963077434 3:141360229-141360251 GTGGGGTCCCAGAGCTAAGATGG - Intronic
964496413 3:157295365-157295387 GTGGAGGCAGTGAGCTATGATGG + Intronic
968737503 4:2304931-2304953 CTCGAGGCCGAGGGCACAGATGG - Exonic
969999293 4:11347735-11347757 CAGCAGGCTGAGAGCCAAGAAGG + Intergenic
978222246 4:106290785-106290807 CAGGAGGCAGAGAGCTCAGGTGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
983372565 4:166879895-166879917 CAGGAGGCAGAGAGAGAAGAGGG - Intronic
988008458 5:25450554-25450576 CTTGAGAGTGAGAGCTAAGAGGG - Intergenic
993747135 5:91614352-91614374 CAGGAGGAAGAGAGCAAAGAGGG + Intergenic
997119884 5:131163372-131163394 CTGAGGGCAGAGAGCTCAGAAGG - Intronic
997146613 5:131440972-131440994 CTGGAGATAGAGAGCTCAGATGG - Intronic
998267459 5:140676942-140676964 CTGAAGCCCCAGAGCTCAGAAGG + Intronic
1000284956 5:159819122-159819144 CTGGAGGAAGAGAGCTTCGACGG + Intergenic
1002188572 5:177467390-177467412 CTAAAGGGTGAGAGCTAAGAGGG + Intronic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002441730 5:179267758-179267780 CTGGAGGCAGAGAGCTGATGTGG + Intronic
1003127599 6:3368040-3368062 CTGAAGGCAGAGAGCAAAGGAGG + Intronic
1004163790 6:13237437-13237459 CAGGAGGCCCAGAACTGAGATGG - Intronic
1004476484 6:15978044-15978066 CAGGAGGAAGAGAGCAAAGAGGG - Intergenic
1006095198 6:31651977-31651999 CTGGAGGACGAGAGGTGGGAGGG + Intronic
1006552446 6:34835896-34835918 CTGGTGGGCGAGAGCTGGGAGGG + Intronic
1007472041 6:42097272-42097294 CTGGAGGCTGTGACCTATGATGG + Intergenic
1008700342 6:54091745-54091767 CTGGAGGCCTAGGGTTTAGAAGG - Intronic
1011134526 6:84085969-84085991 ATGGAGGCAGAGAGCTCAAAGGG + Intronic
1017646626 6:156545190-156545212 CTGGAGGCAAAGAGCTAACCTGG + Intergenic
1018652033 6:165999994-166000016 CTGGAGACTGAGAGCAAGGAGGG - Intergenic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1022783819 7:33615007-33615029 GTGGAGGTGGGGAGCTAAGAAGG + Intergenic
1023370593 7:39508847-39508869 CTGGAGGGCGAGAGTTCTGAGGG - Intergenic
1023881448 7:44323837-44323859 CTGGAGGCCAAGAGGACAGACGG + Intronic
1024896236 7:54265455-54265477 CTGGAAGCTGAGGGTTAAGAAGG + Intergenic
1025969031 7:66304880-66304902 CTGGATGCAGTGAGCTATGATGG - Intronic
1031337241 7:120550699-120550721 CTAGAGGCAGGGAGCTATGAAGG - Intronic
1034857240 7:154563315-154563337 ATGGATGCAGAGAGCTAAGAGGG + Intronic
1035058286 7:156051253-156051275 CTGGAGGCTGAGAGCTAGAGAGG + Intergenic
1037167843 8:15852769-15852791 ATGGAGGTAGAGAGGTAAGAAGG - Intergenic
1038644346 8:29350350-29350372 GGGGCGGGCGAGAGCTAAGAAGG + Exonic
1039081030 8:33734135-33734157 CGGGAGGCCTAGAGCAAAGAAGG + Intergenic
1039695588 8:39906960-39906982 GTGGAGGCTGAGGGCTGAGATGG + Intronic
1039901444 8:41755646-41755668 CTGGAGGTGCAGTGCTAAGAAGG + Intronic
1046226376 8:111285748-111285770 CTGGAGGCCTAGGGGTAAAAAGG - Intergenic
1048248048 8:132830948-132830970 CTGGAGGCCGAGAGCTAAGACGG - Intronic
1048442567 8:134470573-134470595 GTTGAGGCCCAGAGCAAAGAGGG + Intergenic
1049004102 8:139844018-139844040 CTGGAGACCCAGAGCTGAGTGGG - Intronic
1049674503 8:143883693-143883715 CTGGAGCCCGAGGGCCAGGAGGG - Intergenic
1055101686 9:72472090-72472112 CAGGAGGCCAAGAGCTGAAAGGG + Intergenic
1056332392 9:85531999-85532021 CCGGAGGCTCAGAGCTGAGAGGG - Intergenic
1056446403 9:86670320-86670342 CTGCAGGGGGAGAGCTGAGAAGG - Intergenic
1059521939 9:114950837-114950859 CTAGAGGCAGACAGCTAAGTGGG + Intergenic
1059650963 9:116315521-116315543 CTGGAGGCTGAGCGCCAGGAAGG + Intronic
1186120148 X:6351646-6351668 CTGGAGGGCAAGAGCAGAGAGGG + Intergenic
1193737480 X:85175955-85175977 CTGAGGGCAGAGAGCAAAGATGG + Intergenic
1193884576 X:86969621-86969643 CTGGAGTTCGCGAGCCAAGATGG + Intergenic
1196318990 X:114266544-114266566 CTGGAGGCTGAGAGCTACAATGG + Intergenic
1201311068 Y:12598512-12598534 CTGGAGGCCTAGAGGCCAGAGGG + Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic