ID: 1048252314

View in Genome Browser
Species Human (GRCh38)
Location 8:132876947-132876969
Sequence CAGATTGCCCAGTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048252307_1048252314 -9 Left 1048252307 8:132876933-132876955 CCACCCATGCTACCCAGATTGCC 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG No data
1048252305_1048252314 15 Left 1048252305 8:132876909-132876931 CCAGTCTAACTTCAAATGCCTTA 0: 1
1: 0
2: 1
3: 12
4: 176
Right 1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG No data
1048252306_1048252314 -3 Left 1048252306 8:132876927-132876949 CCTTAGCCACCCATGCTACCCAG 0: 1
1: 0
2: 0
3: 14
4: 174
Right 1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048252314 Original CRISPR CAGATTGCCCAGTGGGAAGA AGG Intronic
No off target data available for this crispr