ID: 1048252322

View in Genome Browser
Species Human (GRCh38)
Location 8:132877001-132877023
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048252316_1048252322 23 Left 1048252316 8:132876955-132876977 CCAGTGGGAAGAAGGATCAGATG 0: 1
1: 0
2: 1
3: 16
4: 224
Right 1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG No data
1048252315_1048252322 24 Left 1048252315 8:132876954-132876976 CCCAGTGGGAAGAAGGATCAGAT 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr