ID: 1048253810

View in Genome Browser
Species Human (GRCh38)
Location 8:132889569-132889591
Sequence CAAGGTTAACACATTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048253807_1048253810 -7 Left 1048253807 8:132889553-132889575 CCAGCAATAGAACCCTCAAGGTT 0: 1
1: 0
2: 0
3: 14
4: 59
Right 1048253810 8:132889569-132889591 CAAGGTTAACACATTGATCTTGG No data
1048253805_1048253810 11 Left 1048253805 8:132889535-132889557 CCAATCAAATGTCAAGTTCCAGC 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1048253810 8:132889569-132889591 CAAGGTTAACACATTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048253810 Original CRISPR CAAGGTTAACACATTGATCT TGG Intronic
No off target data available for this crispr