ID: 1048255008

View in Genome Browser
Species Human (GRCh38)
Location 8:132898900-132898922
Sequence CCTGCCTAGAAGTAAGGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048255000_1048255008 5 Left 1048255000 8:132898872-132898894 CCATCTCCAAAAGACCTGTTCGT 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 107
1048254999_1048255008 6 Left 1048254999 8:132898871-132898893 CCCATCTCCAAAAGACCTGTTCG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 107
1048254998_1048255008 15 Left 1048254998 8:132898862-132898884 CCAAGAAAACCCATCTCCAAAAG 0: 1
1: 0
2: 4
3: 22
4: 322
Right 1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 107
1048255001_1048255008 -1 Left 1048255001 8:132898878-132898900 CCAAAAGACCTGTTCGTCCCAGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 107
1048254997_1048255008 16 Left 1048254997 8:132898861-132898883 CCCAAGAAAACCCATCTCCAAAA 0: 1
1: 1
2: 5
3: 41
4: 422
Right 1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 107
1048255002_1048255008 -9 Left 1048255002 8:132898886-132898908 CCTGTTCGTCCCAGCCTGCCTAG 0: 1
1: 0
2: 1
3: 12
4: 107
Right 1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048255008 Original CRISPR CCTGCCTAGAAGTAAGGGTC TGG Exonic
900299447 1:1969543-1969565 CCAGCCTAGAAATAAGGGCTTGG - Intronic
901301179 1:8200962-8200984 CCTGCCTGGAAGTTATGCTCAGG + Intergenic
901652048 1:10748641-10748663 CCTGCCTGGAACTAGTGGTCAGG - Intronic
905570146 1:38997397-38997419 AATGCCTAGAAGTGATGGTCAGG - Intronic
906283441 1:44569694-44569716 CCTGCTGAGAAGCCAGGGTCTGG + Intronic
906316064 1:44787010-44787032 CCTTGCTGGAAGTGAGGGTCCGG + Intronic
907670812 1:56473416-56473438 TCTTCCCAGAAGGAAGGGTCAGG + Intergenic
908825794 1:68131584-68131606 ACTGCCTGGCAGTAAGTGTCAGG - Intronic
909219960 1:72945174-72945196 CAAGCCTAGAAGGAAGGGACAGG + Intergenic
909918668 1:81353168-81353190 AGTGCCTACATGTAAGGGTCTGG - Intronic
910125019 1:83830967-83830989 CCTGCTTATAAGTAATGGTCAGG - Intergenic
910354623 1:86340954-86340976 CCTGCACTGAAGTAAGGGTGGGG - Intergenic
912476770 1:109942974-109942996 CCTACCTAGAGGAAAGGGTATGG + Intergenic
919474612 1:198018513-198018535 CCTGCCCAGATGTAAGGGGCAGG - Intergenic
920310571 1:205045881-205045903 CCTGCCTAGAGGCAAAGGTTGGG + Intronic
921344312 1:214166370-214166392 CCTCCCCAAAAGTAAGGGTTGGG + Intergenic
921875265 1:220188519-220188541 CCTGGCAAAAAGTAAAGGTCTGG + Intronic
922154760 1:223032148-223032170 GCTTCCTGGAAGGAAGGGTCAGG - Intergenic
923224932 1:231930526-231930548 CCTGCCTGGAAGTGACAGTCAGG + Intronic
1065996475 10:31064035-31064057 CCTCCCTTGAAGCAAGGGTCTGG + Intergenic
1066248754 10:33612507-33612529 CCTGCCTAGATTCAAGGGTGAGG + Intergenic
1068012689 10:51474013-51474035 CCTGCCTATAGGTCAGGGTCAGG + Intronic
1073971755 10:109051892-109051914 CCAGCATAGAAGTAAGAATCAGG + Intergenic
1075028792 10:119006698-119006720 CCAGCCAAGAGGTAAGGGACTGG - Intergenic
1075648458 10:124111786-124111808 CCTGCCCTTATGTAAGGGTCAGG + Intergenic
1081803649 11:45877231-45877253 CCTGCTTCCAAGTGAGGGTCAGG - Intronic
1083540180 11:63506872-63506894 CCAGCCTGGAAGGAAGGGTCAGG + Intronic
1083587324 11:63869760-63869782 CCTGCCTAAAAGTCTGGCTCCGG - Intronic
1084968884 11:72758675-72758697 CCTGCCTACAAGGGAGGGTGTGG + Intronic
1086324419 11:85683258-85683280 CCTGCCTGGTGGTAAGGGTTGGG - Intergenic
1089319269 11:117613890-117613912 CTTGCCTAAATGTAGGGGTCTGG + Intronic
1089319616 11:117616139-117616161 CCTGCCTAGAAAGAAGACTCAGG - Intronic
1092208444 12:6631034-6631056 CCTGCCTTGAAGAAGAGGTCAGG + Intronic
1097921673 12:65082116-65082138 CCTGTCTAGAAGTTAGAGTATGG - Intronic
1098865250 12:75755032-75755054 CCTTCCTGGAAGTAAGAGTCAGG - Intergenic
1099331188 12:81290010-81290032 CCTGCCTAGATATAATGGGCTGG - Intronic
1102122448 12:110452081-110452103 CCAGGCTAGAGGGAAGGGTCGGG - Intergenic
1102840577 12:116116242-116116264 TCTCCCTAGAAGTCAGGGTGGGG - Intronic
1104628641 12:130380420-130380442 CCTGCCTAGAAGTAAAGAAGGGG + Intergenic
1108230421 13:48333507-48333529 CCTACCTAGAACTAAGTTTCTGG - Intronic
1108962246 13:56248216-56248238 CCTGCCTAGAGCTAGGGGTGTGG + Intergenic
1109064700 13:57672368-57672390 GTTGCCTAGAGGTAAGGGTGGGG + Intronic
1110780190 13:79456287-79456309 CCTGCCTATAACTAAAGGTGGGG + Intergenic
1112593523 13:100786747-100786769 CCTGTTTAGAAGGTAGGGTCAGG - Intergenic
1114645222 14:24252374-24252396 CCTGCCTGGAAGTAAGGAAAGGG - Intronic
1121959926 14:98249912-98249934 ACACCCTAGATGTAAGGGTCTGG + Intergenic
1122937576 14:104967131-104967153 CCTGCCTAGCACTCAGGGTGGGG + Intronic
1131265514 15:90912998-90913020 CCTGCATATGAGGAAGGGTCTGG + Intronic
1132866742 16:2096941-2096963 CCTCCCTAGAGGGAAGGTTCTGG + Intronic
1134189781 16:12112160-12112182 CCTTCGTAGAAGACAGGGTCGGG + Intronic
1135599324 16:23768627-23768649 CATGCCTAGAAATGAGGATCTGG - Intergenic
1137481006 16:48852136-48852158 CCTGTCTAGAGGCAAGGGGCTGG - Intergenic
1139375155 16:66492370-66492392 CCAGCCTAGCAGTCAGGGCCTGG - Intronic
1140809916 16:78567243-78567265 ACTGCCAAGAAGTAAGGTTTTGG + Intronic
1141260605 16:82450141-82450163 CCTCCTTATAAGTCAGGGTCTGG + Intergenic
1142822366 17:2480360-2480382 CCTCCCTATAAGTTAGTGTCTGG - Intronic
1146254884 17:31386126-31386148 CCTGCCTGGAAGTTAGTTTCAGG + Intergenic
1147327063 17:39674712-39674734 CCTGCCTTGAGGTCAGGGTGGGG - Intronic
1151937854 17:77274276-77274298 CCTGCCAAGAATGGAGGGTCTGG - Intergenic
1153689971 18:7582487-7582509 CCAGCCTAGAATCAAGGGTGGGG + Intronic
1153983720 18:10334505-10334527 CCTGCCGAGTAGGAAGGGACTGG - Intergenic
1154078920 18:11234873-11234895 CCTGCCTTGCAGTCAGGGACTGG + Intergenic
1157281871 18:46351567-46351589 CCTGCTTAGCAGGAAGGGGCTGG - Intronic
1161944799 19:7428926-7428948 CCTCCCTGGGAGCAAGGGTCAGG - Intronic
1164150358 19:22545240-22545262 GTTGCCTAGAAGTGTGGGTCAGG + Intergenic
1164832286 19:31331909-31331931 CCTGCCCAGAAGAAAGTGCCCGG - Intronic
925628932 2:5869089-5869111 CCTTCCTCGAAGGAAGTGTCAGG - Intergenic
932475625 2:72004002-72004024 CCTGCCTGGAAGGAGGGGTAAGG + Intergenic
935704854 2:105847533-105847555 CCTCCCTAGAAGTAAAGACCTGG + Intronic
937118936 2:119428848-119428870 CAGGCCTAGAAGCAGGGGTCAGG + Intergenic
946102175 2:217334982-217335004 CTTGCCTAGATCTTAGGGTCTGG - Intronic
946225777 2:218263369-218263391 CCTGCCTCCAGGTAAGGGCCCGG - Exonic
948407519 2:237733479-237733501 CATTCCTGGAAGAAAGGGTCAGG - Intronic
948469644 2:238168656-238168678 CCTACCTAGAAGTACTGGGCTGG + Intronic
1173183228 20:40820228-40820250 TCTGCCCAGAAGCAAGGCTCTGG - Intergenic
1180657382 22:17434312-17434334 GCTGCCTAGAAGGATGGGTCTGG - Intronic
1181741388 22:24924418-24924440 TCTGCCCAGAAGTAAAAGTCAGG - Exonic
1182050540 22:27309735-27309757 CATTCCTGGAAGGAAGGGTCTGG - Intergenic
951859965 3:27241334-27241356 GCTCGCAAGAAGTAAGGGTCAGG - Intronic
970896682 4:21111700-21111722 GCTGCCTTGGAGTAGGGGTCAGG + Intronic
971505735 4:27364790-27364812 CCTGCCTGGATGTAATGTTCTGG + Intergenic
971505912 4:27366311-27366333 CCTGCCTGGATGTAATGTTCTGG - Intergenic
971753011 4:30675689-30675711 CCTCACTAGAAGGAAGGGTGAGG - Intergenic
974972562 4:68847408-68847430 CTTGCCTAGAATTAAGCTTCTGG + Intergenic
976836895 4:89385031-89385053 CCAGCCTAGACTCAAGGGTCAGG - Intergenic
977000193 4:91488868-91488890 ACTGCATTGTAGTAAGGGTCAGG + Intronic
977180629 4:93869184-93869206 CCTGCCTAGCAGTAAAGAACTGG + Intergenic
988936329 5:36086755-36086777 CCTGCCTAGAAGTCCAGGACTGG + Intergenic
993925668 5:93862983-93863005 TTTTCCTAGAAGTAAGGGCCTGG + Intronic
996261231 5:121471993-121472015 GGTGGCTAGAAATAAGGGTCAGG - Intergenic
999129889 5:149274161-149274183 CCTACCCAGAAGTAAGCTTCAGG + Intronic
1000372674 5:160552161-160552183 CCTGCCCAGAAGAAAGGGAAAGG - Intergenic
1001947167 5:175789057-175789079 CATGCCTAGAACTCAGGGTTAGG + Intergenic
1006614864 6:35319416-35319438 GCTGCCTAGGGGTGAGGGTCTGG - Intronic
1007507353 6:42346261-42346283 CCTGCCTGGAAGGCAGGGGCAGG - Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013820142 6:114145083-114145105 AATGCCAAGAAGTAAGGGTCAGG - Intronic
1015559562 6:134500069-134500091 CCTGCCTAGAGGCAATGGTCTGG - Intergenic
1016417779 6:143851120-143851142 CCTGCCCAGAAGGAAGGGTATGG + Intronic
1018174238 6:161165004-161165026 CCTGCCCAGGAGGAAGGGTATGG - Intronic
1022580700 7:31550687-31550709 CCTTGCTAAAAGCAAGGGTCAGG - Intronic
1026456359 7:70575865-70575887 CCTGCCTCTCATTAAGGGTCTGG + Intronic
1027991871 7:85372995-85373017 TCTGCCTAGATGAAAGGGTATGG + Intergenic
1028553592 7:92099055-92099077 CATGACTAGAAATGAGGGTCTGG - Intronic
1032483209 7:132263061-132263083 GCTGCCTGGATGTAAGGCTCAGG - Intronic
1032665441 7:134031444-134031466 CCTGCCTGGAAGTAAGGAAATGG + Intronic
1033013545 7:137647779-137647801 CCTGCTTAGGAATAAGGGTTAGG + Intronic
1041536484 8:58931704-58931726 CCTGCCTAGACTTAAGAGACTGG + Intronic
1042740778 8:72043151-72043173 CCTGCCTAGAACTGAGGCTTAGG - Intronic
1048255008 8:132898900-132898922 CCTGCCTAGAAGTAAGGGTCTGG + Exonic
1048838452 8:138543854-138543876 AATGCCCAGAGGTAAGGGTCGGG + Intergenic
1048987760 8:139744377-139744399 CCTTCCCAGCAGTCAGGGTCTGG - Intronic
1049843255 8:144787442-144787464 CCTGGCTTGCAGTAAGGCTCCGG + Intergenic
1052083316 9:24233296-24233318 CCTTCCAAAGAGTAAGGGTCTGG - Intergenic
1187473269 X:19588216-19588238 CCTGCAGAGCAGTGAGGGTCAGG + Intronic
1190812661 X:53899752-53899774 CTTGGCAAGAAGTAAGGGTGGGG - Intergenic
1196792737 X:119479224-119479246 CCTGGTTAGAGGTAAGGGTGCGG - Intergenic
1200154747 X:153969495-153969517 CTTGCCCAGAAGGCAGGGTCAGG - Intronic