ID: 1048256660

View in Genome Browser
Species Human (GRCh38)
Location 8:132910119-132910141
Sequence TCCACGTTCTCACCTTCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048256658_1048256660 29 Left 1048256658 8:132910067-132910089 CCCTTGGCACACAGTAGGATCTC No data
Right 1048256660 8:132910119-132910141 TCCACGTTCTCACCTTCACCAGG No data
1048256659_1048256660 28 Left 1048256659 8:132910068-132910090 CCTTGGCACACAGTAGGATCTCA No data
Right 1048256660 8:132910119-132910141 TCCACGTTCTCACCTTCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048256660 Original CRISPR TCCACGTTCTCACCTTCACC AGG Intronic