ID: 1048256660 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:132910119-132910141 |
Sequence | TCCACGTTCTCACCTTCACC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048256658_1048256660 | 29 | Left | 1048256658 | 8:132910067-132910089 | CCCTTGGCACACAGTAGGATCTC | No data | ||
Right | 1048256660 | 8:132910119-132910141 | TCCACGTTCTCACCTTCACCAGG | No data | ||||
1048256659_1048256660 | 28 | Left | 1048256659 | 8:132910068-132910090 | CCTTGGCACACAGTAGGATCTCA | No data | ||
Right | 1048256660 | 8:132910119-132910141 | TCCACGTTCTCACCTTCACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048256660 | Original CRISPR | TCCACGTTCTCACCTTCACC AGG | Intronic | ||