ID: 1048259049

View in Genome Browser
Species Human (GRCh38)
Location 8:132930252-132930274
Sequence CATCTACTCATTTGACCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048259049_1048259052 -1 Left 1048259049 8:132930252-132930274 CCAAGTGGTCAAATGAGTAGATG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG No data
1048259049_1048259051 -5 Left 1048259049 8:132930252-132930274 CCAAGTGGTCAAATGAGTAGATG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1048259051 8:132930270-132930292 AGATGTGAGGAATCAGCATGAGG No data
1048259049_1048259054 11 Left 1048259049 8:132930252-132930274 CCAAGTGGTCAAATGAGTAGATG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1048259054 8:132930286-132930308 CATGAGGATGGCAGACTTGAGGG No data
1048259049_1048259053 10 Left 1048259049 8:132930252-132930274 CCAAGTGGTCAAATGAGTAGATG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1048259053 8:132930285-132930307 GCATGAGGATGGCAGACTTGAGG No data
1048259049_1048259055 21 Left 1048259049 8:132930252-132930274 CCAAGTGGTCAAATGAGTAGATG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1048259055 8:132930296-132930318 GCAGACTTGAGGGACAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048259049 Original CRISPR CATCTACTCATTTGACCACT TGG (reversed) Intronic
902708976 1:18225999-18226021 CATCTACTCACTTAATCACCAGG - Intronic
916323649 1:163533500-163533522 CATTCACTCATTTGCCCAGTAGG - Intergenic
923300530 1:232636376-232636398 CATTTATTCATTTAACAACTAGG + Intergenic
923953004 1:238981401-238981423 CATGTACTTATTTGAGCACAAGG - Intergenic
924129235 1:240888809-240888831 AATCGACTCAGTTAACCACTAGG + Intronic
1063820875 10:9833732-9833754 CCTCTACACATTTGTCCTCTCGG + Intergenic
1063940367 10:11122448-11122470 AATCAACTGATTTTACCACTAGG - Intronic
1068523182 10:58100028-58100050 CTTCTACTCATTTGACATTTTGG - Intergenic
1069845618 10:71368833-71368855 CATTTTCTCATCTGAACACTAGG + Intergenic
1071047543 10:81400574-81400596 CACCCACTCATCTGACCAATTGG + Intergenic
1075594972 10:123722554-123722576 CACACACTCATTTGACCACATGG - Intronic
1075923056 10:126229113-126229135 CATCTGCACATGTGATCACTTGG - Intronic
1089221394 11:116875014-116875036 CATCATATCATTTGTCCACTTGG + Intronic
1092291442 12:7161747-7161769 CATCTCCCCATGTGACTACTGGG + Intergenic
1093339069 12:17949483-17949505 CATCTACAGACTTCACCACTGGG + Intergenic
1094120158 12:26964768-26964790 CATTCACTTATTTGACCATTTGG - Exonic
1096162424 12:49390200-49390222 CATTCACTTATTTGACCACTGGG - Intronic
1099304014 12:80933088-80933110 TATCTCCTCTTATGACCACTTGG + Intronic
1099555101 12:84100977-84100999 CAGCTCCTCTTTTAACCACTGGG - Intergenic
1105571568 13:21608009-21608031 CATCTCCTCATTTTCCAACTGGG - Intergenic
1105576636 13:21659233-21659255 AACCTACTCAATTGACCTCTCGG - Intergenic
1107327729 13:39263154-39263176 CATTTACTCATTTCACCCCAAGG - Intergenic
1107556486 13:41520443-41520465 CACCTACTCCTGTGAGCACTGGG - Intergenic
1108108934 13:47046559-47046581 CATCTACTCATTGCATCACTTGG + Intergenic
1114903820 14:27100140-27100162 CAGCTGCTGTTTTGACCACTTGG + Intergenic
1115202831 14:30872762-30872784 CATCTACCCCTTTGGCCATTTGG + Intergenic
1115712531 14:36066746-36066768 CATGTACTCATCTGACCAATGGG - Intergenic
1117017952 14:51537827-51537849 CATCTGCTCATTTTTTCACTTGG + Intronic
1127834771 15:62782170-62782192 CATGTAATCATGTGTCCACTAGG + Intronic
1131586882 15:93704833-93704855 CATCTATGCCTCTGACCACTTGG - Intergenic
1133798918 16:9069122-9069144 CATCAGCTCTTATGACCACTGGG + Intergenic
1133955259 16:10437561-10437583 TATCTACTCATTTGTCAACAAGG + Intronic
1134277757 16:12791900-12791922 CATCCACTCATTCTAGCACTTGG + Intronic
1152673720 17:81625413-81625435 CATCTACTCTGATGACCCCTCGG - Intronic
1156062243 18:33093301-33093323 CATCTACTCATTTAAGCACAGGG - Intronic
1161612995 19:5253956-5253978 GAACTAGTCATTTGACCACTTGG - Intronic
1164448249 19:28336154-28336176 CAGCTACTCCTGTGACAACTTGG - Intergenic
1167055322 19:47107344-47107366 AATGCACTCATTTGACCACAAGG + Intronic
928264089 2:29796076-29796098 CGTCTTCTCATTTGACCATAAGG - Intronic
929744018 2:44636750-44636772 CATAAACTCATTTTACCAATTGG + Intronic
930897906 2:56466753-56466775 CAACTAAACATTTGACCAATTGG + Intergenic
934578742 2:95421060-95421082 CATCTACACATTTCTCCACCTGG + Intergenic
934600705 2:95655643-95655665 CATCTACACATTTCTCCACCTGG - Intergenic
935461476 2:103340909-103340931 CAAATACTAATTTCACCACTGGG + Intergenic
935534708 2:104280825-104280847 CATCTACTTATTTGAATACAAGG + Intergenic
936534074 2:113297767-113297789 CATCTACACATTTCTCCACCTGG - Intergenic
937377188 2:121345380-121345402 CATCAACTCATTTGAACCTTTGG - Intronic
938784975 2:134619500-134619522 CATCTACTGATGAGACCATTTGG - Intronic
939857679 2:147379861-147379883 CATCTACTCATTTATGTACTAGG - Intergenic
946070525 2:217030747-217030769 CAGCTACTCACTGGGCCACTGGG + Intergenic
946903548 2:224394907-224394929 CAGCTCCTCATTAGACCACCAGG + Intronic
1168923693 20:1562286-1562308 CTTCTCTTCATTTGATCACTTGG - Intronic
1170434564 20:16312612-16312634 TGTCTTCTCATTTGACCACTGGG - Intronic
1171406514 20:24915505-24915527 CGCCTTCTCCTTTGACCACTGGG - Intergenic
1173178351 20:40782611-40782633 CATTCACTTATTTGGCCACTAGG - Intergenic
1176511360 21:7751007-7751029 CACCAACCCATGTGACCACTCGG + Intronic
1176974615 21:15305891-15305913 GATCTACTCATATGACCTTTGGG - Intergenic
1177257170 21:18679700-18679722 CAGCTATTCATTTGAACACATGG + Intergenic
1178368628 21:32008809-32008831 CATCTACTCATTCATCCACGTGG - Intronic
1178631734 21:34267290-34267312 AATCTACCCATTTGAACTCTCGG - Intergenic
1178645474 21:34381536-34381558 CACCAACCCATGTGACCACTCGG + Intronic
1180631428 22:17232801-17232823 CATCCATTCATTCAACCACTGGG - Intergenic
1185285588 22:49998379-49998401 CACCCACTCAAGTGACCACTGGG + Intronic
951845252 3:27078112-27078134 CATCTACACATTTCCCCTCTTGG + Intergenic
955032357 3:55233573-55233595 CATCTACCCATTTGCCCAAGTGG + Intergenic
955106502 3:55903910-55903932 CATCCACTCTTTTGCCCAGTAGG + Intronic
955497764 3:59553557-59553579 CATCTACTGATATGATCACATGG + Intergenic
955605671 3:60700369-60700391 CATCTAATCATTTGACTAATTGG - Intronic
956628298 3:71288967-71288989 CATCATCTTTTTTGACCACTTGG + Intronic
962039327 3:131688435-131688457 CATTTACTCATTTGCCCCTTAGG + Intronic
963969377 3:151412978-151413000 CATCTATTATTTTAACCACTGGG + Intronic
964389025 3:156178415-156178437 CATCTTCTCTTTTCCCCACTAGG - Intronic
971100011 4:23455765-23455787 CATGTCCTCTTTTGACCATTAGG + Intergenic
975833804 4:78399286-78399308 CATCTATTCTTTTGCTCACTTGG - Intronic
977155354 4:93566328-93566350 CAACTACTCATTTGTCCCTTTGG - Intronic
977836911 4:101656084-101656106 CATTTACTCCTTTAACTACTTGG + Intronic
978859579 4:113432072-113432094 TATCTACTCATTTGCACTCTTGG - Intergenic
982286525 4:153741779-153741801 TATCTACTCATTTAACCACAAGG - Intronic
982297499 4:153844728-153844750 CATCAACTCATTTGCCCACCTGG - Intergenic
984348766 4:178565344-178565366 CATCTCCTCATCTGAGCACCCGG - Intergenic
986470664 5:8071153-8071175 CATCTTCTCATGTTATCACTAGG - Intergenic
988197033 5:28016830-28016852 CACCTTTTCATATGACCACTTGG + Intergenic
989107763 5:37879615-37879637 CCTCTACTCATTTGTAAACTAGG + Intergenic
993400528 5:87444774-87444796 AATCTAATCATGTCACCACTTGG - Intergenic
993636901 5:90355333-90355355 CTTCTACTCATGAGACCACAGGG - Intergenic
994001989 5:94791778-94791800 CAGATACTCCTGTGACCACTGGG + Intronic
996755913 5:126934941-126934963 CATGTACACATTTTCCCACTGGG + Intronic
997090525 5:130851164-130851186 CATCTTCTACATTGACCACTAGG + Intergenic
997343490 5:133166170-133166192 CATCTTCTCATGTGCTCACTGGG + Intergenic
997472888 5:134126440-134126462 CATCTGTTCATTTCACCACTGGG + Intronic
998770667 5:145541036-145541058 TATCTACACTTTTGACAACTTGG - Intronic
998860147 5:146435150-146435172 CATCCATTCATTTGTCCATTTGG - Intergenic
1001972145 5:175965326-175965348 CATCTACACATTTCCCCATTTGG + Intronic
1002245295 5:177878451-177878473 CATCTACACATTTCCCCATTTGG - Intergenic
1003155013 6:3585952-3585974 CATCTATTCATTAGTCCACAAGG + Intergenic
1006260831 6:32868376-32868398 CCACTACCCATTTGGCCACTAGG - Intergenic
1010247539 6:73675642-73675664 CATCAACTTCCTTGACCACTAGG + Intergenic
1011717954 6:90126865-90126887 TATCTTTTCTTTTGACCACTCGG - Intronic
1012846942 6:104402180-104402202 CATCTACTCTTAAGCCCACTTGG + Intergenic
1013763577 6:113548156-113548178 CATCTATTCAATTGATCATTTGG - Intergenic
1014787988 6:125639761-125639783 CACCAACTCATTTGACCTCAGGG - Intergenic
1017809074 6:157971146-157971168 CATCTACTCATTTTACCCCCAGG - Intergenic
1018105117 6:160478465-160478487 CATCTACACATTTGAACATTGGG - Intergenic
1018113232 6:160557347-160557369 TATCTACACATTTGAACATTGGG - Intronic
1020671346 7:11117896-11117918 TAACTATTCATTTGACCTCTGGG + Intronic
1024032683 7:45477474-45477496 CATCTACTGATATGACCATATGG - Intergenic
1024401761 7:48931770-48931792 CATTTAATCATTTGAAAACTAGG - Intergenic
1028768149 7:94583779-94583801 CATATAGTCATTTGCCCACTAGG + Intergenic
1030636685 7:111957699-111957721 CATACACTCATTTGGACACTGGG - Intronic
1032784204 7:135187646-135187668 CATATAATCAATTGAACACTGGG + Intronic
1034825340 7:154257332-154257354 CATCTTCTCATCTGCCCTCTGGG + Intronic
1036140330 8:6201649-6201671 CATCTTTTCAGTTGACAACTGGG - Intergenic
1037984565 8:23280217-23280239 CATACATTCATTTGACAACTTGG - Intronic
1038813600 8:30878141-30878163 AATCTACTCATATAACAACTTGG - Intronic
1047230443 8:122993759-122993781 AATCTACTCATCTGACAAATGGG - Intergenic
1048259049 8:132930252-132930274 CATCTACTCATTTGACCACTTGG - Intronic
1051352077 9:16206329-16206351 CAGCAGCTCATTTGAGCACTCGG + Intronic
1052402637 9:28019878-28019900 CATCTCCTCATTTGACAAGTAGG - Intronic
1052944589 9:34157880-34157902 CCTCTGCCCATTTTACCACTGGG - Intergenic
1057822723 9:98344866-98344888 AAACTACTCTTTTGTCCACTGGG + Intronic
1058148239 9:101435167-101435189 CATTTCCTCATTTGAGCAGTGGG + Intronic
1185930620 X:4199357-4199379 CCTTTACTCATTAGACAACTAGG - Intergenic
1187932342 X:24304997-24305019 CATTTAATAATTTGGCCACTAGG + Intergenic
1189526514 X:41828083-41828105 ATTCTCCTCATTTGACAACTAGG + Intronic
1191784610 X:64903902-64903924 TAACTACTCATTTGACCCCAGGG + Intergenic
1192606074 X:72519562-72519584 CATCTTCTCATTTGCCTATTAGG + Intronic
1194337656 X:92667033-92667055 CATCTATTCATTTTTCCCCTAGG - Intergenic
1198977964 X:142358476-142358498 GGTCCACTCATTTGTCCACTTGG + Intergenic
1199901891 X:152182125-152182147 CATCTACTGAGATGACAACTTGG + Intronic
1200646071 Y:5783775-5783797 CATCTATTCATTTTTCCCCTAGG - Intergenic
1201240137 Y:11951041-11951063 CATTTATTCAATTGAACACTTGG + Intergenic