ID: 1048259052

View in Genome Browser
Species Human (GRCh38)
Location 8:132930274-132930296
Sequence GTGAGGAATCAGCATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048259049_1048259052 -1 Left 1048259049 8:132930252-132930274 CCAAGTGGTCAAATGAGTAGATG 0: 1
1: 0
2: 0
3: 14
4: 116
Right 1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048259052 Original CRISPR GTGAGGAATCAGCATGAGGA TGG Intronic
No off target data available for this crispr