ID: 1048261019

View in Genome Browser
Species Human (GRCh38)
Location 8:132945050-132945072
Sequence GTTTTTATTCTAATAACGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048261015_1048261019 15 Left 1048261015 8:132945012-132945034 CCACAGTGAGGAGAACCTTGTAG 0: 1
1: 0
2: 1
3: 37
4: 661
Right 1048261019 8:132945050-132945072 GTTTTTATTCTAATAACGACTGG No data
1048261014_1048261019 20 Left 1048261014 8:132945007-132945029 CCAGGCCACAGTGAGGAGAACCT 0: 1
1: 0
2: 2
3: 12
4: 261
Right 1048261019 8:132945050-132945072 GTTTTTATTCTAATAACGACTGG No data
1048261018_1048261019 0 Left 1048261018 8:132945027-132945049 CCTTGTAGGCGGCATGAATAGTT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1048261019 8:132945050-132945072 GTTTTTATTCTAATAACGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048261019 Original CRISPR GTTTTTATTCTAATAACGAC TGG Intronic
No off target data available for this crispr