ID: 1048261219

View in Genome Browser
Species Human (GRCh38)
Location 8:132946775-132946797
Sequence GAGTGCAACTGAAGCTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048261218_1048261219 -9 Left 1048261218 8:132946761-132946783 CCTCAGGGTCACAGGAGTGCAAC 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1048261219 8:132946775-132946797 GAGTGCAACTGAAGCTAAGCTGG No data
1048261216_1048261219 1 Left 1048261216 8:132946751-132946773 CCTTGAATGGCCTCAGGGTCACA 0: 1
1: 0
2: 4
3: 20
4: 146
Right 1048261219 8:132946775-132946797 GAGTGCAACTGAAGCTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048261219 Original CRISPR GAGTGCAACTGAAGCTAAGC TGG Intronic
No off target data available for this crispr