ID: 1048267281

View in Genome Browser
Species Human (GRCh38)
Location 8:132998717-132998739
Sequence CTAAGCTGCACTTGCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048267281_1048267283 -3 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267283 8:132998737-132998759 TAGGAAAACTACAATTTAAATGG No data
1048267281_1048267287 23 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267287 8:132998763-132998785 TGGAGTTCAATGCCTTGGCAGGG No data
1048267281_1048267288 28 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267288 8:132998768-132998790 TTCAATGCCTTGGCAGGGTTTGG No data
1048267281_1048267289 29 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267289 8:132998769-132998791 TCAATGCCTTGGCAGGGTTTGGG No data
1048267281_1048267286 22 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267286 8:132998762-132998784 ATGGAGTTCAATGCCTTGGCAGG No data
1048267281_1048267284 3 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267284 8:132998743-132998765 AACTACAATTTAAATGGTGATGG No data
1048267281_1048267290 30 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267290 8:132998770-132998792 CAATGCCTTGGCAGGGTTTGGGG No data
1048267281_1048267285 18 Left 1048267281 8:132998717-132998739 CCATATCAGCAAGTGCAGCTTAG 0: 1
1: 0
2: 0
3: 18
4: 100
Right 1048267285 8:132998758-132998780 GGTGATGGAGTTCAATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048267281 Original CRISPR CTAAGCTGCACTTGCTGATA TGG (reversed) Intronic
900321143 1:2084690-2084712 CTGACCTCCACTTGCTGACAAGG - Intronic
901754627 1:11434121-11434143 CTAAGATGCACTGGGTGCTAGGG - Intergenic
903230118 1:21916780-21916802 ATAATCTGCACTGTCTGATATGG - Intronic
903597902 1:24510426-24510448 CGAAGCAGCAAGTGCTGATATGG - Intronic
908979547 1:69938784-69938806 CTATGCTGTAATTGCTTATAAGG - Intronic
910119417 1:83769032-83769054 CTAAGCTGCAATTCGAGATATGG - Intergenic
911995325 1:104758361-104758383 CTAAGGTGCCCCTGCTGAGAAGG - Intergenic
915283669 1:154839456-154839478 CTAAGCACCACCAGCTGATAGGG + Intronic
915983461 1:160438714-160438736 CTAAGTTCCACTGGGTGATACGG + Intergenic
917106659 1:171499008-171499030 CTAAGTTGCACAGGCTGATCTGG + Intronic
920047211 1:203141060-203141082 CTCAGCTGCATTCGCTGAAATGG - Intronic
924437213 1:244052504-244052526 CCAAAATGCACTTGCTGAGATGG + Intronic
1066705763 10:38175885-38175907 CTGTGCTGCACTTGCAGAGATGG - Intergenic
1066984667 10:42454464-42454486 CTATGCTGCACTTGCAGAGATGG + Intergenic
1067370641 10:45678716-45678738 CTATGCTGCACTTGCAGAGATGG - Intergenic
1067389134 10:45847427-45847449 CTATGCTGCACTTGCAGAGATGG + Exonic
1067416929 10:46109519-46109541 CTATGCTGCACTTGCAGAGATGG - Intergenic
1067445124 10:46337122-46337144 CTATGCTGCACTTGCAGAGATGG - Intergenic
1067502340 10:46816414-46816436 CTATGCTGCACTTGCAGAGATGG - Intergenic
1067592247 10:47523606-47523628 CTATGCTGCACTTGCAGAGATGG + Exonic
1067639364 10:48031679-48031701 CTATGCTGCACTTGCAGAGATGG + Intergenic
1067874123 10:49988614-49988636 CTATGCTGCACTTGCAGAGATGG - Intronic
1068132144 10:52908050-52908072 CTTAGGTGCTGTTGCTGATATGG - Intergenic
1070136356 10:73697835-73697857 CTATGCTGCACTTGCAGAGATGG + Exonic
1070447948 10:76526340-76526362 CTAAAATGCACATGCTGAAAAGG - Intronic
1070499056 10:77053292-77053314 CAAAGCTGCACTTGCTGGATGGG + Intronic
1072135995 10:92547037-92547059 TTAAGCTGCCCTTGCTGTTCTGG - Intronic
1073508590 10:104025391-104025413 CTGAGCTGGACTTGCACATAGGG + Intronic
1084855288 11:71980722-71980744 CTAAGCTGCACTACCTATTATGG + Intronic
1085459309 11:76683704-76683726 CTCAACTGCCCTTGCTGAGAAGG - Intergenic
1093654970 12:21684125-21684147 CTAAGGTGCACTAGATGATAGGG - Intronic
1094051483 12:26225939-26225961 CTAAGGTGCAGATGCTGAGATGG - Intronic
1104665484 12:130644543-130644565 TTAATTTGCACTTGATGATACGG - Intronic
1106720413 13:32429516-32429538 TTAACCTGCACTGGCTAATATGG + Intergenic
1107683355 13:42872173-42872195 GAAAGCAGCACTTGCTGCTAAGG + Intergenic
1108039930 13:46330659-46330681 CCAGGCTGCACTTGCTGCTCTGG - Intergenic
1109717002 13:66231307-66231329 AAAAGCGGGACTTGCTGATAAGG + Intergenic
1110555389 13:76853733-76853755 CCAAGCTGACCTTGCTGAGATGG - Intergenic
1114249886 14:20950050-20950072 CTAAGCAGCACTTGATCAAAAGG + Intergenic
1115140394 14:30164386-30164408 CTCAGTTGCACTTGCTTATCAGG + Intronic
1116973180 14:51089607-51089629 GTAAGCTGAAATAGCTGATAAGG - Intronic
1119326295 14:73761374-73761396 CAAACCTGCACTTGCTTCTAAGG + Intronic
1120984337 14:90320533-90320555 CTAAGATGCAAATACTGATATGG - Intronic
1125131751 15:36290534-36290556 AAAAGCGGCACTTGCTGCTAAGG + Intergenic
1128716866 15:69914925-69914947 ATAAACTGGACTTGCTGAAAAGG + Intergenic
1130973244 15:88751909-88751931 TTAAGTTGCACTAGCTGAAATGG + Intergenic
1137008322 16:35298904-35298926 GGGAGCTGGACTTGCTGATATGG + Intergenic
1139143921 16:64301476-64301498 CTAAGACACACTTGGTGATATGG + Intergenic
1139560915 16:67741470-67741492 GATAGCTGAACTTGCTGATAAGG + Intronic
1139751988 16:69114525-69114547 CGAAGCTGCACTTGCTGCCTAGG - Exonic
1141505084 16:84471619-84471641 CTTTGCCGCACATGCTGATATGG + Intergenic
1148077884 17:44949712-44949734 CTACACTGCAGATGCTGATAAGG + Intergenic
1153135771 18:1916096-1916118 CTAAGCTGCACTGTCCAATAAGG + Intergenic
1154379740 18:13838333-13838355 TTCAGCTGCACTTGCTGTAAAGG + Intergenic
1155932515 18:31722605-31722627 CTAAGCTGAGCCTGCTGATGAGG - Intergenic
1160804749 19:987587-987609 CTAGGATGCAGTTGCTGAGAGGG + Intronic
1161102203 19:2426773-2426795 CCAAGCTGCACTGGCTGGCAGGG + Exonic
1166609917 19:44182041-44182063 TTAGGCTGGATTTGCTGATATGG + Intergenic
1166796805 19:45431153-45431175 GGAAACTGCACTGGCTGATATGG - Intronic
931426535 2:62176964-62176986 TGAAGCTGTATTTGCTGATAGGG + Intergenic
933360767 2:81281108-81281130 CTAAGATGCACTTTCCCATATGG - Intergenic
935419904 2:102855927-102855949 ATAATCTATACTTGCTGATATGG - Intergenic
937744663 2:125397520-125397542 ATAAGCTTCTCTTGCTGTTAGGG + Intergenic
945185386 2:207134565-207134587 CTAAGCTGTTTTTCCTGATATGG + Intronic
1170261137 20:14409716-14409738 TTTAGCTGCACTTGCTCAGATGG + Intronic
1173127871 20:40356756-40356778 CTAAGCTGCTCATCCTCATAGGG + Intergenic
1175081001 20:56420206-56420228 AAAAGCTGCTCTTGATGATAAGG - Intronic
1178228395 21:30751920-30751942 GTAAGCTGCACTGTCTGATATGG - Intergenic
952752844 3:36839438-36839460 CTAAGTGGCACATGCTGATAAGG + Intronic
957751984 3:84432085-84432107 CTCATCTGCAATTTCTGATATGG + Intergenic
968770542 4:2503195-2503217 CTAAGCTGCTCTTGCTAAAAGGG + Intronic
981644374 4:146981937-146981959 TTCAGCAGCATTTGCTGATAGGG - Intergenic
983928433 4:173427650-173427672 CTTAGCTGCACTTGCTGCTCTGG + Intergenic
985241187 4:187932455-187932477 CTAAACTACACTTGCTCATCTGG + Intergenic
986644188 5:9900596-9900618 CTAAGATACACTTGCTCAAATGG + Intergenic
986664008 5:10084203-10084225 CTCTGCTGCATTTGCTGATGTGG - Intergenic
987037682 5:14034711-14034733 CTAAGCCTTAGTTGCTGATATGG - Intergenic
990494895 5:56337616-56337638 CTAAGCTCCACTTGCCAATAAGG + Intergenic
994959780 5:106584435-106584457 CTAGTCAGCACTTGCAGATAGGG - Intergenic
995385813 5:111587570-111587592 CTCAGCTGCATTTGATGACATGG + Intergenic
1001308159 5:170590791-170590813 CTGAGCTGCACTGGCTGCCATGG - Intronic
1002822391 6:737862-737884 CTGGTCTCCACTTGCTGATAAGG - Intergenic
1002900991 6:1409654-1409676 CTCTGATGCACTTACTGATAAGG + Intergenic
1003376342 6:5581204-5581226 CTCAGCTGCACTCGGTGCTAAGG - Intronic
1003889678 6:10552947-10552969 CTCAGCTGCACTGGCAGAAAAGG - Intronic
1006993898 6:38239916-38239938 CCAGGCTGCTCTTTCTGATAAGG - Intronic
1007017745 6:38486248-38486270 CAAAGCAGCCATTGCTGATATGG - Intronic
1010256431 6:73763711-73763733 TTAAGCTGAACTTACTGCTATGG - Intronic
1010288101 6:74102640-74102662 CTATGGTGCACTTGGTGACAAGG - Intergenic
1011282304 6:85689255-85689277 CTAAGCTGCCCATCCTTATATGG + Intergenic
1012672877 6:102077725-102077747 CTTACCTGAACTTACTGATATGG - Intergenic
1015591590 6:134827878-134827900 CTAAGAGGCACTTTCTGATTTGG - Intergenic
1018988711 6:168657376-168657398 CTGGGCTACACTTGCTGTTAGGG + Intronic
1019953751 7:4395245-4395267 CTATGCTTTACTTTCTGATATGG + Intergenic
1027556056 7:79666086-79666108 TAAAGCTACACTAGCTGATATGG - Intergenic
1028876527 7:95829614-95829636 CTAAATTACACTTGCTGATGTGG + Intronic
1028997057 7:97112606-97112628 CTAAGCTCTACTTACTGAAATGG + Intergenic
1032701329 7:134382109-134382131 CTGAGCTGAACTTACTCATAGGG - Intergenic
1033228995 7:139582263-139582285 CCAGGCTGTACTTGCTGCTAGGG - Intronic
1033971693 7:147048754-147048776 CTAAGCTGCACTGTCTAATATGG - Intronic
1034972228 7:155426539-155426561 TCCAGCTGCACTTACTGATATGG - Intergenic
1035542695 8:454266-454288 TTAAGCTGCATTTGAAGATATGG + Intronic
1039194838 8:35019608-35019630 CTAAGCTGCAGATGCTAACAAGG + Intergenic
1039440137 8:37589272-37589294 CTAATCTTCATTTACTGATATGG - Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1046824310 8:118670433-118670455 CTAAGCTGTTCTTGATCATATGG + Intergenic
1048267281 8:132998717-132998739 CTAAGCTGCACTTGCTGATATGG - Intronic
1048279113 8:133091544-133091566 CAAAGCTGCCCTTGTTGAAATGG - Intronic
1051764787 9:20511796-20511818 CTAAGCTTTACTTGCTGAAGAGG - Intronic
1055599676 9:77902809-77902831 GAAAGCTGCACTGGCTGATTGGG - Intronic
1058376629 9:104329424-104329446 CTAAGCGCCACGTGCTGCTAGGG + Intergenic
1059981156 9:119773462-119773484 CTAATCTGCTCTTCCGGATAAGG + Intergenic
1061603028 9:131685253-131685275 CAAAGCTGCCCTTGCTTTTATGG + Intronic
1186125578 X:6410221-6410243 CTATGAGGCAATTGCTGATAAGG + Intergenic
1186939264 X:14487268-14487290 ATAATCTGCACTGTCTGATATGG - Intergenic
1188908624 X:35819220-35819242 GTAAACTGCGTTTGCTGATAAGG + Intergenic
1188930502 X:36104134-36104156 CTAAGCTGCATGAGCTGGTAAGG + Intronic
1192759845 X:74085817-74085839 CTATGCTGCTCCTGCTGAGAAGG + Intergenic
1193438835 X:81513527-81513549 CTAAGCTCTATTTGCTTATAAGG - Intergenic