ID: 1048267582

View in Genome Browser
Species Human (GRCh38)
Location 8:133001041-133001063
Sequence ACACGTGCACAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048267582_1048267588 24 Left 1048267582 8:133001041-133001063 CCATCTTCCCTCTGTGCACGTGT 0: 1
1: 0
2: 7
3: 42
4: 332
Right 1048267588 8:133001088-133001110 CAAGGACACCAGACCACCATTGG No data
1048267582_1048267585 6 Left 1048267582 8:133001041-133001063 CCATCTTCCCTCTGTGCACGTGT 0: 1
1: 0
2: 7
3: 42
4: 332
Right 1048267585 8:133001070-133001092 CAACATTTCCCTTTTTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048267582 Original CRISPR ACACGTGCACAGAGGGAAGA TGG (reversed) Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900892674 1:5460914-5460936 ACAATGGCACATAGGGAAGATGG + Intergenic
901131020 1:6962635-6962657 GCAGGTCCACAGAGGAAAGAGGG - Intronic
902268498 1:15286524-15286546 AGACGTGGAGAGAGGGAAGGTGG - Intronic
902768249 1:18630963-18630985 ACCCGGGGACAGACGGAAGAAGG - Intergenic
903298706 1:22362861-22362883 ACACCTGCCCATAGGAAAGAGGG + Intergenic
904112524 1:28137453-28137475 AAACTTACACAAAGGGAAGAGGG - Intergenic
905224729 1:36471779-36471801 ACAAGGGAACAGAGGGAAAAGGG - Intronic
909023098 1:70453402-70453424 GCAGGTGAAAAGAGGGAAGAAGG + Intergenic
909772629 1:79442742-79442764 ACACAGACGCAGAGGGAAGATGG + Intergenic
911595051 1:99790056-99790078 AGATATGCATAGAGGGAAGATGG - Intergenic
912540923 1:110414689-110414711 AGATGTACATAGAGGGAAGATGG + Intergenic
912681936 1:111734310-111734332 AAAGGTGGTCAGAGGGAAGAGGG - Intronic
913157239 1:116111855-116111877 ACACGTACACAGAGTGCACACGG - Intronic
913692888 1:121296253-121296275 ACACATGCACAGAGAGGGGATGG + Intronic
915464231 1:156086953-156086975 AGAAGTGCTCAGAGGAAAGAAGG - Intronic
917961075 1:180145160-180145182 AGAAGTGCAGAGAGGAAAGATGG + Intergenic
918194519 1:182208925-182208947 ACAAGTCCAGAGAGGCAAGATGG + Intergenic
918424385 1:184393299-184393321 ACAGGGGCCCTGAGGGAAGAAGG - Intronic
918817404 1:189206498-189206520 ACACATACACACAGGGAAGATGG - Intergenic
919566903 1:199200198-199200220 ACGCGTTCACTGAGGGAAGAGGG - Intergenic
919579348 1:199352122-199352144 AGACTTGCACAGAGGGAGGTGGG - Intergenic
920039894 1:203088722-203088744 AAACTTGCACAGAGGGGAGGAGG + Intergenic
920281204 1:204845069-204845091 GCTCGGGCACAGAGGGAAGTAGG - Intronic
920617450 1:207507426-207507448 ACACAGACCCAGAGGGAAGACGG - Intronic
920620110 1:207537228-207537250 ACACAGACCCAGAGGGAAGATGG - Intronic
920621892 1:207555783-207555805 ACACAGACCCAGAGGGAAGATGG - Intronic
920623518 1:207572877-207572899 ACACAGACCCAGAGGGAAGATGG - Intronic
920636084 1:207705128-207705150 ACACAGACCCAGAGGGAAGATGG - Intronic
920693275 1:208163110-208163132 ACAGGGGCACTTAGGGAAGAGGG + Intronic
921219921 1:212966147-212966169 ACAGGAGCACGGAGGGAAAAGGG - Intronic
922419465 1:225449765-225449787 ACAGTCGCACAGTGGGAAGATGG + Intergenic
922494287 1:226043767-226043789 AGACATGCATAGAGGAAAGATGG - Intergenic
923251663 1:232184153-232184175 ACAGATAGACAGAGGGAAGAGGG + Intergenic
924016863 1:239736101-239736123 ACATGTGCACATAGGGAAAGTGG - Intronic
924260730 1:242228114-242228136 ACACTTGCACACGAGGAAGATGG + Intronic
1063217947 10:3940855-3940877 ACACATACACAAAGGGAAGGTGG + Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064174946 10:13066730-13066752 ACACGTGCACTGGGGGAACGGGG + Intronic
1064796250 10:19014831-19014853 ACACAGACACAGAGGGAAGAAGG + Intergenic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1067328592 10:45293181-45293203 ACCTGAGCACAGAGGGAAGCAGG + Intergenic
1068514422 10:58008453-58008475 ACAGCAACACAGAGGGAAGAAGG + Intergenic
1069671032 10:70204015-70204037 ACACAGGAAGAGAGGGAAGAAGG - Intronic
1069964046 10:72099132-72099154 ACATGGGCACAAAGAGAAGAAGG - Intronic
1070219891 10:74430356-74430378 ATAGGTGAACAGAGGGAAGTGGG - Intronic
1071525813 10:86357561-86357583 ACACGTGCACATATGCATGAGGG - Intronic
1072002827 10:91214360-91214382 ATAGATGCACAGAGAGAAGACGG + Intronic
1074559743 10:114524778-114524800 ACAAGGGCACAGAAGGAAAAGGG + Intronic
1074876658 10:117618889-117618911 ACACAGACACAGAGGGAAGAAGG + Intergenic
1075256942 10:120932842-120932864 AGACTCACACAGAGGGAAGAAGG + Intergenic
1075271129 10:121052088-121052110 ACACATACACAGATGGCAGAGGG + Intergenic
1075539082 10:123297242-123297264 ACAAACACACAGAGGGAAGATGG - Intergenic
1076295813 10:129383492-129383514 AGACAAGCACAGAGGAAAGACGG - Intergenic
1076445385 10:130510451-130510473 ACACGTGCACAGCGGAGAGCTGG - Intergenic
1076854222 10:133108044-133108066 ACATGTGGAGAAAGGGAAGAAGG - Intronic
1076863726 10:133157021-133157043 ACACACGCACAGAGGGACGGGGG + Intergenic
1077397700 11:2332932-2332954 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1078606683 11:12783435-12783457 ACACGTGCCAATAGGGAGGAAGG + Intronic
1078889547 11:15542110-15542132 ACATATGCGCAGATGGAAGAAGG - Intergenic
1079946964 11:26755858-26755880 ACTCATGAACAGAGGGAAGGGGG + Intergenic
1080839400 11:35970336-35970358 AGACACTCACAGAGGGAAGATGG + Intronic
1081587642 11:44398324-44398346 CCCCCGGCACAGAGGGAAGAGGG - Intergenic
1081615950 11:44591296-44591318 ACAGAGGCACAGAGGGGAGAAGG - Intronic
1083550175 11:63582359-63582381 CAACCAGCACAGAGGGAAGAAGG + Intronic
1086532583 11:87803285-87803307 ACACATACTCAGAGGGAAGATGG - Intergenic
1087022670 11:93618837-93618859 ACACACACACAGAGGGAAGAAGG - Intergenic
1087220166 11:95538537-95538559 ACAAAAGCACAGAAGGAAGAAGG - Intergenic
1087339238 11:96881565-96881587 ACACAATCCCAGAGGGAAGAAGG - Intergenic
1088358588 11:108968386-108968408 ACACAGACACACAGGGAAGATGG + Intergenic
1088453829 11:110012686-110012708 TCACATGCAATGAGGGAAGATGG - Intergenic
1088678486 11:112219351-112219373 GCACGGGCACAGAGGGAAGTAGG - Intronic
1089054348 11:115573074-115573096 ACGTGTGAACAGAGGGAAAACGG + Intergenic
1089683915 11:120134825-120134847 ACACAGGCACAGAGGAAGGAAGG - Intronic
1090873901 11:130771830-130771852 ACACATCCCCAGAGGGAAGGAGG + Intergenic
1091735726 12:2920114-2920136 ACACATGCACGGAGGACAGATGG - Intronic
1091760714 12:3085414-3085436 GCAGATGCACAGAGGAAAGACGG - Intronic
1091988358 12:4932843-4932865 ACAAACGCACAGGGGGAAGACGG - Intergenic
1092514750 12:9198535-9198557 ACACATGCACAGAGAAGAGAAGG + Intronic
1092719651 12:11428857-11428879 ACACATGTACCCAGGGAAGAAGG - Intronic
1096600057 12:52722707-52722729 TCACGTGAACTGAAGGAAGAGGG - Intergenic
1097238497 12:57556479-57556501 AAAAGAGCAGAGAGGGAAGAAGG - Intronic
1099215407 12:79847045-79847067 ACACGTCCACAGAGGGAAAAAGG + Intronic
1100361579 12:93884505-93884527 CCACCTGCACACAGGGAGGACGG + Intronic
1100726007 12:97409385-97409407 AAACGTGTACAGAGGGAAAATGG - Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1101735720 12:107461363-107461385 ACACAGACACAGATGGAAGAAGG + Intronic
1101751798 12:107588103-107588125 ACACAGACACAGAGGAAAGAGGG - Intronic
1102823657 12:115928139-115928161 AGACGCGCACAGAAGGAAGGCGG + Intergenic
1103456701 12:121072979-121073001 ACACAGGCACAGAGGAAAGAAGG - Intergenic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1105914785 13:24903401-24903423 AGACACACACAGAGGGAAGATGG + Intronic
1107080553 13:36370144-36370166 AAACATGCACAGACGGAAGGTGG + Intronic
1110452924 13:75657069-75657091 AGACATGCACAGAGGGATGAAGG + Intronic
1110531198 13:76600978-76601000 ACACCGGCACAGAGGGAAGATGG + Intergenic
1111220324 13:85196809-85196831 ACAAATACACAGATGGAAGATGG + Intergenic
1111958559 13:94784129-94784151 AGATGCACACAGAGGGAAGAAGG + Intergenic
1113880068 13:113620012-113620034 ACAAACACACAGAGGGAAGAGGG - Intronic
1114334371 14:21672647-21672669 TCACCTGCACAGACTGAAGAGGG + Intergenic
1116683306 14:48005649-48005671 ACACTTGAACAAAGGCAAGAAGG - Intergenic
1118987532 14:70769727-70769749 ACAGATACACAAAGGGAAGATGG - Intronic
1120343431 14:83251886-83251908 ACACATACACAGATTGAAGAAGG + Intergenic
1122394571 14:101414424-101414446 ACAGAGGCACAGAGGGAAGAAGG + Intergenic
1124264642 15:28221570-28221592 AGACCTGCAATGAGGGAAGATGG + Intronic
1124940817 15:34216081-34216103 ACACAGACACATAGGGAAGAAGG - Intergenic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126810937 15:52403198-52403220 ACAAGGGCAAAGAGGAAAGATGG + Intronic
1129319639 15:74767436-74767458 AGAGGTTCAGAGAGGGAAGATGG + Intergenic
1129453105 15:75661687-75661709 AGACTTGGCCAGAGGGAAGATGG + Exonic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1130671201 15:85914436-85914458 ACACATGAATAGAAGGAAGAAGG - Intergenic
1130733451 15:86523327-86523349 ACTTGGACACAGAGGGAAGATGG - Intronic
1130759670 15:86805522-86805544 ACATGTGCACAATAGGAAGAGGG + Intronic
1131177220 15:90217638-90217660 AGAGGACCACAGAGGGAAGATGG + Intronic
1131296577 15:91154679-91154701 AGACACACACAGAGGGAAGATGG + Intronic
1131352438 15:91713464-91713486 AGACATGAACAGAGAGAAGATGG - Intergenic
1131626515 15:94126318-94126340 ACACATGGACAGAAGAAAGATGG - Intergenic
1132557176 16:577840-577862 ACAGGTCCCCAGAGGGAGGATGG - Intronic
1133030349 16:3007928-3007950 CCAAGTGCACAGCGGGAAGCAGG - Intergenic
1133190243 16:4128369-4128391 ACAGAGGCACAGAAGGAAGATGG + Intergenic
1135839705 16:25864055-25864077 ACACACACACAGAGAGAAGAGGG - Intronic
1137264081 16:46854372-46854394 ACAGGTGCACTGAGGGAGGGTGG - Intergenic
1137529833 16:49272121-49272143 AAACTTTCAAAGAGGGAAGAGGG - Intergenic
1138024476 16:53511888-53511910 ACACATGGACAGAGGGCAGCAGG + Intergenic
1139430644 16:66909375-66909397 ACACGATCACTGAGGGGAGAGGG + Exonic
1140021352 16:71241961-71241983 TCACCAGCACAGAGGAAAGAAGG + Intergenic
1140153271 16:72394537-72394559 ACATGTGTAAAGATGGAAGAAGG + Intergenic
1140819711 16:78651668-78651690 ACACCTGCACAGGTGGGAGAAGG - Intronic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1141762486 16:86038042-86038064 ACATTTGCAGAGAAGGAAGAGGG + Intergenic
1142957504 17:3531645-3531667 ACAGTGGCACACAGGGAAGACGG + Intronic
1143397565 17:6614288-6614310 ACACGTGCACAGAGGAAGCCAGG + Intronic
1143677637 17:8447490-8447512 TTAAGAGCACAGAGGGAAGATGG - Intronic
1144022632 17:11250745-11250767 ACACGTGAGCAGAGTTAAGAGGG - Intronic
1144145478 17:12393716-12393738 ACACAGCCATAGAGGGAAGATGG - Intergenic
1144202680 17:12955523-12955545 ACTCCTGCACACAGGGAACATGG + Intronic
1145005877 17:19337460-19337482 GCACTTGCACAGAGAGCAGAGGG - Intergenic
1145254071 17:21313365-21313387 ACACGTGCACCCAGGGAAGAAGG - Intronic
1145322526 17:21774598-21774620 ACACGTGCACCCATGGAAGAAGG + Intergenic
1148117375 17:45184394-45184416 ACACATGCATAGAGGGAAGATGG - Intergenic
1149206809 17:54257331-54257353 AAAAGTGCAGAGAGGGAAGAAGG + Intergenic
1149520251 17:57313301-57313323 ACACGTCCACACTCGGAAGATGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152384833 17:79966184-79966206 ACCCATATACAGAGGGAAGAAGG - Intronic
1152556733 17:81056978-81057000 CCACGTCCACAGAGGAATGAAGG - Intronic
1152761242 17:82108062-82108084 TCACGTGGACAGAGGCAAGGAGG - Intronic
1152786346 17:82249924-82249946 ACACGTGCAGAAAGAGGAGAGGG + Intronic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154069193 18:11137782-11137804 ACAGGTGCAGAAAAGGAAGAAGG - Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1155064218 18:22254791-22254813 CCACCTGGAAAGAGGGAAGAAGG - Intergenic
1155162757 18:23208910-23208932 ACACATGCACGAAGGGAAGAAGG - Intronic
1156254900 18:35385609-35385631 ACTCAGACACAGAGGGAAGAAGG - Intergenic
1156531074 18:37815677-37815699 ACAAATGCACAGAGGACAGAAGG + Intergenic
1158565755 18:58553009-58553031 ACAGAGACACAGAGGGAAGAAGG + Intronic
1158717545 18:59894149-59894171 ACACAGGCACACAGGGGAGAAGG + Intergenic
1159951654 18:74488488-74488510 AGACATACACAGAGGGAAGATGG + Intergenic
1160216318 18:76935633-76935655 GAGCTTGCACAGAGGGAAGACGG - Intronic
1160692905 19:468015-468037 ACACCTGCGCAGAGGTTAGAGGG - Intronic
1161322294 19:3646893-3646915 ACAGGAGGACAGAGGGAGGAAGG + Intronic
1162088451 19:8262279-8262301 CCAGTTGCCCAGAGGGAAGAAGG - Exonic
1163637447 19:18443838-18443860 ACAAGTGGACAGAGGGACGGAGG + Exonic
1164627330 19:29738155-29738177 ACAAGTGCACAGTGGGTAGCAGG - Intergenic
1165601967 19:37061231-37061253 ACACGTGCAAACAGGGAAAGGGG - Intronic
1165710370 19:38006406-38006428 GCACGTTAAGAGAGGGAAGAGGG + Intronic
1165742445 19:38211910-38211932 CCACTTGCACAGAGGGGAGGGGG + Exonic
1166337258 19:42115906-42115928 ACAGGTGCACAGAGAGAAGATGG + Intronic
1166534276 19:43562417-43562439 TCACATGCAAAAAGGGAAGATGG + Intronic
1167590997 19:50404224-50404246 AGACACGCACAGAGAGAAGACGG - Intronic
1168433849 19:56302488-56302510 AGAAGGGCAGAGAGGGAAGAAGG - Intronic
925017487 2:542569-542591 ACACAAACACAGAGGGCAGAAGG + Intergenic
925263515 2:2548023-2548045 ACAGGGGGACAGAGAGAAGATGG - Intergenic
925790048 2:7475457-7475479 ACACACACACAGAGGGAGGATGG + Intergenic
926101378 2:10120533-10120555 AAACGAGCACCGAGGGAAAAAGG + Intergenic
926702793 2:15815023-15815045 ACATTTGCACAGAAGGAAAATGG - Intergenic
927422585 2:22948749-22948771 ACAGGTCCACAGATGGAATAAGG + Intergenic
927478975 2:23435342-23435364 ACAGGTGCACATTTGGAAGATGG + Intronic
928995227 2:37282335-37282357 ACAGGTGGCCAGAGGAAAGACGG + Intronic
929526145 2:42704751-42704773 ACTGGTGCACTGAGGGAACATGG - Intronic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929731181 2:44494414-44494436 GTACGTAAACAGAGGGAAGAGGG - Intronic
930145956 2:48004578-48004600 ATGCGTGCACAGAGGGAACTAGG + Intergenic
932226942 2:70048904-70048926 AGAGGGACACAGAGGGAAGATGG - Intergenic
932833373 2:75011635-75011657 ACAAGGGCAGAGAGAGAAGATGG + Intergenic
932887690 2:75561706-75561728 AAGCTTGGACAGAGGGAAGACGG + Intronic
933203828 2:79482323-79482345 ATACATGCACACAGGGATGAAGG + Intronic
933634984 2:84699023-84699045 AAAAGAGCACAGAGGGAAGGAGG + Intronic
934962632 2:98690344-98690366 ACACTTGCTAAGAGGGGAGAAGG - Intronic
935132732 2:100273095-100273117 ACAGACACACAGAGGGAAGAAGG + Intergenic
935212703 2:100952224-100952246 CCTCGTGCACAGAGGGCAAAGGG + Intronic
936685251 2:114820336-114820358 ACACTTGCACAAAGGTAAGAGGG + Intronic
936804940 2:116319743-116319765 ACAAGTCCACAGATTGAAGAGGG - Intergenic
937437751 2:121893241-121893263 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
938404810 2:131025534-131025556 ACACTTGAACAGATGGAAGCTGG - Intronic
939986622 2:148835112-148835134 ACATGGACACAGAGAGAAGATGG - Intergenic
941712567 2:168729540-168729562 ACTGGTCCACACAGGGAAGAAGG - Intronic
943375789 2:187075174-187075196 ACACTTGCACAGCTGGAGGATGG - Intergenic
944853424 2:203743370-203743392 ACAAATGCACAGAAGGAAGGGGG + Intergenic
945163487 2:206918183-206918205 ACACCAGCACTGAGGGAGGAGGG + Intergenic
946972131 2:225105820-225105842 AGACTTGAACAGAGGGATGAGGG - Intergenic
947344037 2:229172536-229172558 AGACGTGCACTGAGGAAAGAGGG - Intronic
947501742 2:230675879-230675901 ACAGGTGGGCAGAGGAAAGAGGG - Intergenic
947569511 2:231221253-231221275 ACACAGACACAGAAGGAAGACGG - Intronic
947953633 2:234169447-234169469 AGAGGCACACAGAGGGAAGATGG - Intergenic
948024763 2:234768207-234768229 ACACAGACACAGAGGGCAGAAGG - Intergenic
949042102 2:241854216-241854238 CCATGGGCACAGAGGGAACAGGG - Intronic
1169017707 20:2305195-2305217 CCACGTCCACAGAGGGGAGAGGG - Intronic
1169241956 20:3989602-3989624 ACATGTGTGCAGAAGGAAGATGG - Intronic
1169298102 20:4417317-4417339 ACAGATGCACAGAGGGCAGATGG + Intergenic
1169319152 20:4616951-4616973 ACACAGACACAGAGGGAAGATGG - Intergenic
1169408694 20:5348607-5348629 GCACATACACAGAGGGCAGATGG + Intergenic
1169593516 20:7171943-7171965 TGAAGTGCAGAGAGGGAAGAAGG + Intergenic
1172612149 20:36260298-36260320 GGAAGTGGACAGAGGGAAGAGGG - Intronic
1172986992 20:38999606-38999628 ACACGTGCACATTGGAAAGAAGG - Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1175170038 20:57073967-57073989 ACAGACACACAGAGGGAAGAAGG - Intergenic
1175321629 20:58092351-58092373 ACACAGACACAGAGAGAAGAAGG + Intergenic
1175327634 20:58140746-58140768 ACACAAACACACAGGGAAGAAGG - Intergenic
1176035779 20:63035800-63035822 ACACGGGGACACAGAGAAGATGG + Intergenic
1177489007 21:21797198-21797220 ACAGACACACAGAGGGAAGAAGG + Intergenic
1177658708 21:24054329-24054351 GCACATGCACAGAGGGAAGAAGG - Intergenic
1178890864 21:36520183-36520205 ACAGACCCACAGAGGGAAGACGG - Intronic
1179278798 21:39916158-39916180 CCATGTGCTCAGAGAGAAGAAGG + Intronic
1179427505 21:41293588-41293610 AAAAGTTCACAGAAGGAAGATGG - Intergenic
1179496713 21:41776483-41776505 ACACCTGCACTAAGGGAAGTGGG + Intergenic
1179938592 21:44622630-44622652 ACACACACACAAAGGGAAGACGG - Intronic
1179964742 21:44795864-44795886 ACATGCACACAGGGGGAAGATGG + Intronic
1180062123 21:45390870-45390892 ACAGGAGCTCAGAGGGAAGAGGG + Intergenic
1181768408 22:25108744-25108766 ACAAGTGCCCAGAGGCAAGTAGG - Intronic
1182267207 22:29126484-29126506 AGACACACACAGAGGGAAGATGG - Intronic
1182430309 22:30295226-30295248 TCACGTGCCCAGAAGGAAGGAGG + Intronic
1182558724 22:31142768-31142790 AGACGATCACACAGGGAAGAAGG - Intergenic
1184522279 22:45001953-45001975 ACACGTGCTCATCGGGAAAATGG - Intronic
1184997297 22:48217666-48217688 AAACACGCACAGAGGGATGACGG + Intergenic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
949166949 3:954382-954404 ACATGTGCACTGGGGGAACAGGG - Intergenic
949976742 3:9467686-9467708 ACACGTGAAGAGAGTGAAGGTGG - Intronic
950641245 3:14349895-14349917 AGACAGGCACAGAGGGAAGATGG + Intergenic
955076695 3:55620656-55620678 ACAGCTGCACAGAGGGAACTGGG + Intronic
955136588 3:56225013-56225035 ACACATGGACAGGGGGAACAAGG - Intronic
955574578 3:60346434-60346456 ATATGTGCACTGAGGGAAGTGGG + Intronic
955865825 3:63382790-63382812 AAAACAGCACAGAGGGAAGATGG - Intronic
955877237 3:63504887-63504909 TCACGTGGACAGAGGGATGTAGG + Intronic
959115628 3:102174628-102174650 ACACGACCACAAAGGGAAGCAGG + Intronic
960152208 3:114261901-114261923 ACACATGCACAGAGGGAGGGAGG + Intergenic
960714386 3:120560716-120560738 ACTCGTGAAAAGAGGAAAGAGGG - Intergenic
961017914 3:123481765-123481787 ACCCGTGCAGAGAGGGCTGAGGG + Intergenic
961632195 3:128309274-128309296 GCAGGTGCAAAGAGGGCAGAGGG + Intronic
961684431 3:128619548-128619570 ACTCCTGCAGAGAGGAAAGAGGG + Intergenic
962564437 3:136642931-136642953 AGAGGCACACAGAGGGAAGATGG - Intronic
963779239 3:149470481-149470503 ACAAGAGCAAAGATGGAAGATGG - Intergenic
966223104 3:177569986-177570008 ACACACAGACAGAGGGAAGATGG - Intergenic
967993598 3:195150342-195150364 GCGCCAGCACAGAGGGAAGAAGG - Intronic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968680956 4:1919186-1919208 AAACTAGCACAGAGGGAAGTGGG + Intronic
969373860 4:6750377-6750399 ACACGGGCACAGAGGGGCTAGGG + Intergenic
976704320 4:88006012-88006034 AGACGCATACAGAGGGAAGAGGG + Intergenic
977188936 4:93976118-93976140 ACAGATACACAGAGGGAAGATGG - Intergenic
977200239 4:94106697-94106719 ACAGAGACACAGAGGGAAGATGG - Intergenic
977494789 4:97761339-97761361 ACAAACGTACAGAGGGAAGATGG + Intronic
978264197 4:106803091-106803113 ACATGAGGAAAGAGGGAAGAGGG - Intergenic
980651582 4:135723763-135723785 ACACGTGCACACAGGAAACTTGG - Intergenic
981668111 4:147254302-147254324 ACACGTGCACTGAAGGAAGCGGG + Intergenic
981735510 4:147945994-147946016 ACACGCGCACTGGGGGAACAGGG - Intronic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
984706763 4:182852886-182852908 AAACAGGCATAGAGGGAAGACGG + Intergenic
984883853 4:184432731-184432753 ACACAGACACAGAGGGAGGATGG + Intronic
986091321 5:4511423-4511445 ACACGTGCAGGGAGGGACTAAGG - Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
987108418 5:14663305-14663327 AAATGTGCACAGAGGGAAGAAGG - Intergenic
987278940 5:16392801-16392823 ACAAAAGCACAGAGGAAAGATGG - Intergenic
987610923 5:20201225-20201247 ACAGGCACACAGAGAGAAGATGG - Intronic
989642791 5:43599705-43599727 ACACAGGCACATAGAGAAGAAGG + Intergenic
989715107 5:44453957-44453979 ACCTGTGCACTGGGGGAAGAGGG - Intergenic
990009732 5:50982359-50982381 ACACTTGCACACAGAGGAGAAGG + Intergenic
990311485 5:54543210-54543232 ACACGTGGAGGAAGGGAAGATGG + Intronic
990423230 5:55658482-55658504 ACAGACACACAGAGGGAAGAAGG + Intronic
991581082 5:68155816-68155838 ACACACACACAGAGGGAAGAAGG - Intergenic
992456185 5:76918121-76918143 ACACGTGCATAGAGGTATGGAGG - Intronic
994260811 5:97656390-97656412 AAACATGCACAGAAGGAAGAGGG + Intergenic
1001079308 5:168655360-168655382 ACACAGACACACAGGGAAGAAGG + Intergenic
1001457675 5:171877529-171877551 ACAAGTTCACATAGGGCAGAGGG + Intronic
1002551436 5:179995702-179995724 ACACTTCCCCAGTGGGAAGATGG + Intronic
1003429003 6:6022000-6022022 AGGCATGCACAGAGGGAAGATGG + Intergenic
1003498641 6:6686426-6686448 AGACACCCACAGAGGGAAGACGG - Intergenic
1003924728 6:10867013-10867035 ACACATGGACACAGGGAGGAGGG + Intronic
1004894888 6:20139004-20139026 ACACATGCATACAGGGAAGACGG - Intronic
1004917046 6:20341842-20341864 ACACCTGCAGGGAGGGAAGCAGG + Intergenic
1005967170 6:30734943-30734965 TCATCTGCTCAGAGGGAAGAAGG + Intronic
1006832947 6:36979812-36979834 ACAGGTGGGCAGATGGAAGAGGG - Intronic
1008200205 6:48577817-48577839 AGACCTGCACAGAGAAAAGATGG + Intergenic
1008694645 6:54020581-54020603 GCAAGTGCACAAAGTGAAGATGG + Intronic
1010950413 6:82030510-82030532 AGACATGCACAGAGGGAAGGTGG - Intergenic
1010958321 6:82116925-82116947 AAACCTGCACAAAGGGAACAAGG + Intergenic
1013072810 6:106744188-106744210 AGACGGGCACAGAGGGAAGTGGG - Intergenic
1013508865 6:110826639-110826661 ACACAAATACAGAGGGAAGACGG - Intronic
1013943251 6:115691488-115691510 ACACATACACAGGGAGAAGATGG + Intergenic
1014686598 6:124508849-124508871 ATAGATGCACAGAGAGAAGATGG - Intronic
1016404782 6:143718613-143718635 ACATGTGCACTGAGGAAAGCAGG - Intronic
1017437486 6:154430175-154430197 ACACTTACACAAAGGAAAGATGG - Intronic
1018305677 6:162452798-162452820 CTACGTGGACAGAGGGAAGTGGG + Intronic
1018591175 6:165424112-165424134 ACACAGGCAAAGAGGAAAGAGGG - Intronic
1019215120 6:170438563-170438585 ACACGGGCACAGATGGAGGGTGG - Intergenic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1020260735 7:6529497-6529519 CCAACTGCACAGATGGAAGAAGG + Intronic
1020831984 7:13103899-13103921 AGACATGCACAGAGGGATAACGG + Intergenic
1022093867 7:27125879-27125901 ACAGGGGGACAGAGGAAAGATGG + Intronic
1022423713 7:30247559-30247581 ACACGTTCACAAAGGCAAGCTGG - Intergenic
1022525191 7:31032641-31032663 ACACATGGAGAGAGGGGAGATGG + Intergenic
1023237147 7:38101323-38101345 TCAAATACACAGAGGGAAGAAGG + Intergenic
1023346898 7:39279690-39279712 AGACACACACAGAGGGAAGATGG - Intronic
1023350702 7:39317770-39317792 TCAAGTGCACACAGAGAAGAAGG - Intronic
1025782606 7:64615224-64615246 GCACCTGCCCACAGGGAAGATGG + Intergenic
1026540857 7:71278881-71278903 AGAGATACACAGAGGGAAGAAGG - Intronic
1026540942 7:71279477-71279499 AGACACACACAGAGGGAAGAAGG - Intronic
1026617480 7:71918668-71918690 GCACGTTCCCAGAAGGAAGAAGG + Intronic
1027930969 7:84534492-84534514 AGACATGCACAGAGAGGAGAAGG - Intergenic
1027965346 7:84998764-84998786 ACAGGTTCACAGAGAGAAGTTGG - Exonic
1029364993 7:100111044-100111066 ACAAGGGGGCAGAGGGAAGAGGG - Intronic
1031311088 7:120197813-120197835 AGACACACACAGAGGGAAGAAGG + Intergenic
1031478537 7:122250982-122251004 CCACAGGCACAGAGGTAAGATGG + Intergenic
1032171445 7:129587889-129587911 ACACGAGGCCAGAGGCAAGAAGG - Intergenic
1033684967 7:143630462-143630484 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033685431 7:143636028-143636050 GCTCGGGCACAGAGGGAGGAGGG - Intronic
1033688140 7:143709681-143709703 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033688601 7:143715246-143715268 GCTCGGGCACAGAGGGAGGAGGG - Intronic
1033699183 7:143821592-143821614 GCTCGGGCACAGAGGGAGGAGGG + Intergenic
1033699646 7:143827159-143827181 AAAAATGCACAGAAGGAAGAAGG + Intergenic
1037154911 8:15687891-15687913 CCACATGCACAGAGGGATTATGG + Intronic
1037817256 8:22118788-22118810 ACAGGTGCAGAGAAGGCAGAGGG - Intronic
1038437104 8:27543880-27543902 ACGGGTGCTCAGAGGGAAGACGG + Intronic
1038616717 8:29102356-29102378 ACAGTTACACAGAGGGAAGCTGG + Intronic
1038862460 8:31402202-31402224 ACACGTGCTCACAGGGAAGCTGG + Intergenic
1039263082 8:35794206-35794228 ACACATTTACAGAGGGCAGAGGG - Intronic
1039718249 8:40134114-40134136 ACGCGTGGGCAGAGGAAAGAGGG - Intergenic
1040950385 8:52933439-52933461 ACAGTTGCACATAAGGAAGAGGG + Intergenic
1042102065 8:65284561-65284583 TCAAATGCACAAAGGGAAGAGGG - Intergenic
1042424189 8:68627252-68627274 AGACCAGCACAGAGGGTAGAAGG - Intronic
1043766854 8:84146364-84146386 ACACCTGGACAGAGGGAGGGGGG + Intergenic
1044435141 8:92153070-92153092 ACAGGTGTACAGCAGGAAGAGGG - Intergenic
1046010413 8:108539591-108539613 ACACAGACACAGAGGGAAGATGG + Intergenic
1046310541 8:112430839-112430861 ACAGGTCAACAGAGGGAAAAGGG + Intronic
1046760553 8:118015888-118015910 GCACAGACACAGAGGGAAGATGG + Intronic
1047663326 8:127062375-127062397 AGACATGTACAGAGGGAAGATGG - Intergenic
1048253167 8:132884055-132884077 AGACAGACACAGAGGGAAGATGG - Intronic
1048253371 8:132885927-132885949 AAAGATGCACACAGGGAAGAAGG - Intronic
1048267582 8:133001041-133001063 ACACGTGCACAGAGGGAAGATGG - Intronic
1048590477 8:135816590-135816612 ACAGGGGCACAGAAGGGAGAAGG + Intergenic
1048599357 8:135902579-135902601 ACACACACACACAGGGAAGAAGG - Intergenic
1050075296 9:1856563-1856585 ACAGGTGCTTAGAGGGAAGTAGG - Intergenic
1050083294 9:1938263-1938285 ACACATGCACAGAGTGCTGAGGG + Intergenic
1050555942 9:6789758-6789780 ACACGTGAACAGAGGCAGGTAGG + Intronic
1050575743 9:6993653-6993675 ACCCGTGCACTTAGGGGAGAGGG + Intronic
1051589036 9:18757514-18757536 ACAGATGCGCAGAGGGATGAAGG - Intronic
1054805881 9:69395630-69395652 ATACGGGTGCAGAGGGAAGAGGG - Intergenic
1055280741 9:74671213-74671235 ACAGATGAAGAGAGGGAAGAAGG + Intronic
1055394631 9:75861032-75861054 ACATGTCCACAGAGAGAAGAGGG - Intergenic
1055554996 9:77464925-77464947 ACACAGACACAGAGGGAAGATGG + Intronic
1055635843 9:78278447-78278469 ATACGTGCACACAAGGAAGGTGG - Intronic
1057047450 9:91897344-91897366 CCACTTGTACAGAGGAAAGAAGG + Intronic
1057701537 9:97366393-97366415 ACACGGGCAGACAGGGAAGGAGG + Intronic
1057899072 9:98933609-98933631 ACTCATGCCCAGAGAGAAGAAGG - Intergenic
1059127908 9:111711348-111711370 ACACCTGCGCACTGGGAAGACGG + Intronic
1060173996 9:121483815-121483837 ACACCTCCACAGAGGTAAGCAGG - Intergenic
1062064209 9:134517615-134517637 CCACGTGGACAGAGGGATCATGG + Intergenic
1062114685 9:134802048-134802070 TCACTTGCCCACAGGGAAGAGGG + Intronic
1062339342 9:136087064-136087086 ACAGATGCACAGAAGGAAGGTGG + Intronic
1062482990 9:136761042-136761064 ACAGATGCACAGAAGGAAGGTGG + Intronic
1203585776 Un_KI270747v1:2136-2158 ACAGATGCAGAGAGGGAGGATGG + Intergenic
1185585042 X:1236494-1236516 AGACGGGCCCAGAGGGCAGAGGG - Intergenic
1186989181 X:15049341-15049363 ACACAAACACAGAGGAAAGATGG + Intergenic
1187843369 X:23511141-23511163 ACACAGACACAGAAGGAAGAAGG - Intergenic
1189122073 X:38405430-38405452 ACACAGACACAGAGGGAAAATGG - Intronic
1194585787 X:95732515-95732537 ACACCTGCGGAGAGGGCAGATGG - Intergenic
1194592359 X:95815137-95815159 AGAGGGGCACAGAGGGAAAATGG - Intergenic
1198659284 X:138949440-138949462 ACACGGGCACACAGGTGAGAAGG - Intronic
1200182356 X:154158495-154158517 ACACGCAGACAGAGGGAAGAAGG - Intronic
1200188010 X:154195609-154195631 ACACGCAGACAGAGGGAAGAAGG - Intergenic
1200193660 X:154232749-154232771 ACACGCAGACAGAGGGAAGAAGG - Intronic
1200199415 X:154270553-154270575 ACACGCAGACAGAGGGAAGAAGG - Intronic