ID: 1048267683

View in Genome Browser
Species Human (GRCh38)
Location 8:133001845-133001867
Sequence CCACACCTGCACAGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048267683_1048267689 16 Left 1048267683 8:133001845-133001867 CCAGCCAGCCTGTGCAGGTGTGG 0: 1
1: 0
2: 2
3: 33
4: 324
Right 1048267689 8:133001884-133001906 TTCCCAGCTATTCCATATTCAGG 0: 1
1: 0
2: 0
3: 16
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048267683 Original CRISPR CCACACCTGCACAGGCTGGC TGG (reversed) Intronic
900228492 1:1543941-1543963 GACCACGTGCACAGGCTGGCAGG + Exonic
900375228 1:2351181-2351203 GCACAGCTGCCCAGGGTGGCCGG + Intronic
900507699 1:3037892-3037914 CCCCAGCTGCACAGGCGGCCGGG - Intergenic
901645984 1:10716985-10717007 CTTCACCAGCACAGGCAGGCGGG + Intronic
902334654 1:15747880-15747902 CCACCCCTGCCCAGGAAGGCAGG - Exonic
905016854 1:34783707-34783729 ACACACGTGGACAGGCAGGCGGG + Intronic
905337837 1:37257658-37257680 CCAGACAGGCACAGGCTGGGTGG - Intergenic
905402741 1:37715443-37715465 CCTCTCCTGAACATGCTGGCCGG + Intronic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
906706686 1:47900143-47900165 CCACACCCCCTCAGTCTGGCAGG - Intronic
907316644 1:53576765-53576787 CCACACCAGCACAGGCTCGAGGG + Intronic
907931053 1:59000508-59000530 CTGCACCTCCACAGGCTGACTGG + Intergenic
913487252 1:119342859-119342881 CAACACATGCCCAGGGTGGCCGG + Intergenic
915230364 1:154441429-154441451 CCACACATGCATAGGGTGGAGGG - Intronic
916502866 1:165401457-165401479 GCACACCTGCACCTGCTGGCAGG + Intronic
917014850 1:170518434-170518456 CAACCCCTGCACAGGCTGCTTGG + Intergenic
918304347 1:183232451-183232473 CCACTTCTGCAAGGGCTGGCTGG - Intronic
922750244 1:228066877-228066899 CCACCCAAACACAGGCTGGCTGG + Intergenic
922803674 1:228375199-228375221 CCACTCCTGCATAGGCTGGAGGG - Intronic
922823722 1:228502669-228502691 CTACAGCTGCAGAGGCTGTCTGG + Intergenic
1064443532 10:15373200-15373222 ACGCACCTGCACAGGGTGGCAGG + Intergenic
1067831171 10:49611797-49611819 CCACACCTGCAGTGGCTGTACGG + Exonic
1069753218 10:70758075-70758097 GCTCACCTCCACAGGCGGGCAGG - Exonic
1071244915 10:83751919-83751941 TCACCCCTTCACAGGCTAGCAGG + Intergenic
1072718667 10:97767680-97767702 CCACAGCTGGACAGCCTGGCGGG - Exonic
1075695714 10:124433692-124433714 CCACACCTGCACAAGCAAGCTGG - Intergenic
1076576935 10:131475567-131475589 CCTCTCCTGCACAGACTGCCCGG + Intergenic
1078951334 11:16137890-16137912 GCACATCTTCACAGGGTGGCAGG - Intronic
1079003969 11:16779670-16779692 CCTCTCATGCTCAGGCTGGCGGG + Intronic
1080793226 11:35539621-35539643 CAACACTTGCAAAGGCAGGCTGG + Intergenic
1083184942 11:61012175-61012197 GTACAACTGCACAGGCTGCCGGG + Intronic
1083805723 11:65072649-65072671 GCACACCTGCCCAGGCTGGTGGG + Intronic
1084773126 11:71357200-71357222 TCACCACTGCCCAGGCTGGCTGG - Intergenic
1084777559 11:71387462-71387484 ACACACCTGGCCTGGCTGGCTGG - Intergenic
1087175468 11:95091193-95091215 CCACCCCTGCCCAGGCTGCTGGG + Intronic
1088621806 11:111692458-111692480 CCACACATGCAAAGGCTGAGAGG + Intronic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1089345409 11:117788145-117788167 CCATACCAGCTCAGGCTGCCTGG - Intronic
1094870878 12:34598645-34598667 CCACACATGCACAGGGTGCTGGG + Intergenic
1095049447 12:37543472-37543494 CCACATCTGCTAAGGCAGGCAGG - Intergenic
1095951541 12:47784384-47784406 CCACTCCCGCACAGCCTGACAGG + Intronic
1102458336 12:113084863-113084885 CCAAAACAGTACAGGCTGGCTGG - Intronic
1103479932 12:121244452-121244474 CCACAGCAGCCCAGGCTGGAAGG + Intronic
1103931503 12:124453243-124453265 CCACAGCCACACAGGCTGGGGGG + Intronic
1104805245 12:131585858-131585880 CCACCCTTGCACAGCCAGGCAGG + Intergenic
1105431450 13:20340826-20340848 CCACACCAGCACTTTCTGGCTGG + Intergenic
1105457306 13:20553540-20553562 ACAAAGCAGCACAGGCTGGCTGG - Intergenic
1105932508 13:25066105-25066127 CCACAAGTGCACAGGCTGTGAGG - Intergenic
1106080410 13:26495951-26495973 TCCCACCTGCAGATGCTGGCAGG + Intergenic
1106546707 13:30737173-30737195 CCCCAACTGCACAGGCAGGGAGG - Intronic
1108148897 13:47510825-47510847 TCACAACTCCACAGGCAGGCTGG + Intergenic
1108891491 13:55266150-55266172 CCACCTCTTCACAGGCTGGCAGG + Intergenic
1111737726 13:92163924-92163946 GCACATCTTCACAGGGTGGCAGG + Intronic
1111750178 13:92319541-92319563 ACACACCTACACAGGTTGTCTGG + Intronic
1112189518 13:97162698-97162720 CTCCACCAGCACAGACTGGCTGG + Intergenic
1112739803 13:102459901-102459923 ACACACCTGCTCAAGATGGCCGG + Intergenic
1113833163 13:113312784-113312806 ACACACCTAGACAGGCTGCCAGG - Intronic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1115398415 14:32934176-32934198 CCATTCCTGCACACGCGGGCTGG + Intergenic
1116720662 14:48491348-48491370 TCACCTCTTCACAGGCTGGCAGG + Intergenic
1117235663 14:53772070-53772092 CAACACCTGCACAGGCAGCAGGG - Intergenic
1117455886 14:55896526-55896548 CCACCTCTTCACAGGGTGGCAGG - Intergenic
1118665316 14:68062781-68062803 TCACTCTTGCCCAGGCTGGCAGG - Intronic
1121155678 14:91681881-91681903 GCACACATGAACAGGCAGGCTGG - Intronic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1122359303 14:101150216-101150238 CCACACCTGCAGCGGAGGGCAGG - Intergenic
1122814934 14:104307648-104307670 CCTCTCCTGCCCAGGCTGCCAGG - Intergenic
1122918878 14:104871440-104871462 CCACACCTGCCCTGGCTCTCCGG + Intronic
1123127057 14:105954224-105954246 GCACACATGCACATGCTTGCTGG - Intergenic
1123427424 15:20183866-20183888 CGACACCTGGGCAGGCTGGCTGG + Intergenic
1123536660 15:21190416-21190438 CGACACCTGGGCAGGCTGGCTGG + Intergenic
1123719579 15:23049319-23049341 CCACACCTGGCCAGACTTGCCGG + Intergenic
1124819202 15:33027216-33027238 CCATACCTCCACAGGGTGCCAGG + Intronic
1125420224 15:39497629-39497651 ACACACCTGCACTGGCAAGCTGG + Intergenic
1127148468 15:56049833-56049855 CCTCTACAGCACAGGCTGGCAGG - Intergenic
1129939360 15:79480261-79480283 CCACAGTTCCAAAGGCTGGCAGG + Intergenic
1130977736 15:88790142-88790164 TCACTCCAGCACAGGCTGACTGG - Intergenic
1131051174 15:89349111-89349133 TGCCACCTGCACAGGCTGCCGGG + Intergenic
1131247955 15:90812238-90812260 CTACCCCTGCAAAGGCTGGGAGG - Intronic
1132216483 15:100065877-100065899 CCACCCCTCAACAGGCTGGGGGG + Intronic
1132623311 16:878564-878586 CCACACGTGCACAGACGGGACGG + Intronic
1132802611 16:1761791-1761813 CCACACATTCACACGCTGGGCGG + Intronic
1132850667 16:2023626-2023648 CCAGAGCTGCTCAGGCAGGCGGG - Intergenic
1133023282 16:2976302-2976324 CCAGCCCTCCCCAGGCTGGCAGG - Intronic
1133349152 16:5090048-5090070 CACCACCTGCACAGGGTGCCCGG + Intronic
1133493579 16:6295463-6295485 ACACAGCTCCACAGGCTGGAAGG - Intronic
1134197221 16:12168542-12168564 CCATAACTGAACAGGCTGACGGG + Intronic
1135401044 16:22166271-22166293 CCAAACCTACAAAGGCTGCCAGG + Intergenic
1135526118 16:23214971-23214993 CCGACCCTGCACAGGCTGGGAGG - Intronic
1136174633 16:28508243-28508265 CCCCAGCTGCATAGGCTGCCGGG - Intronic
1136856865 16:33665943-33665965 CGACACCTGGGCAGGCTGGCTGG - Intergenic
1137653160 16:50137501-50137523 CCACCCCTGCCCAGAGTGGCAGG - Intergenic
1139037696 16:62967482-62967504 CCACACCTGCAATGGCTTACAGG - Intergenic
1139510273 16:67424160-67424182 CCGCCCCTGCACAGGCTCCCTGG + Intergenic
1141054260 16:80802649-80802671 CCCCACCTGAACCTGCTGGCCGG + Intronic
1141682207 16:85551319-85551341 CCACACCAGGACAGACTGCCAGG - Intergenic
1142196951 16:88743353-88743375 CCACCCCGGCACGTGCTGGCAGG + Intronic
1203118440 16_KI270728v1_random:1514418-1514440 CGACACCTGGGCAGGCTGGCTGG - Intergenic
1142540615 17:655856-655878 AACCACCTGCACATGCTGGCAGG - Exonic
1142703538 17:1679368-1679390 CCTCACTTTCACAGGCTGCCCGG + Exonic
1144539856 17:16130374-16130396 CCTCAACTCCACAGGGTGGCTGG + Intronic
1144780024 17:17803355-17803377 AAAAACCTGTACAGGCTGGCTGG - Intronic
1144783009 17:17817227-17817249 CCAAAGATGCCCAGGCTGGCCGG + Intronic
1144846737 17:18224220-18224242 CCACACCAGCACAGGCAGCAGGG - Intergenic
1145239260 17:21230467-21230489 CCACAGCTGCACAGCCAGGAGGG - Intergenic
1145378947 17:22376633-22376655 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379426 17:22379003-22379025 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145379904 17:22381373-22381395 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380384 17:22383748-22383770 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145380863 17:22386095-22386117 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145381342 17:22388470-22388492 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382075 17:22392244-22392266 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382550 17:22394609-22394631 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145382830 17:22395972-22395994 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383403 17:22398795-22398817 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145383917 17:22401263-22401285 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384355 17:22403465-22403487 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145384674 17:22404927-22404949 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1145993461 17:29092653-29092675 CCACACCATCCCAGGCTGGGCGG + Intronic
1146618211 17:34373621-34373643 CCCCATCTGCACAGGCTTCCAGG + Intergenic
1146933313 17:36793370-36793392 CCACACTGGCCCAGGCTGGAAGG + Intergenic
1147034800 17:37671867-37671889 CAGCACCTGCACTGGCTGGAGGG + Intergenic
1147582615 17:41635811-41635833 CAGCACCTTCACAGGCTGGGCGG - Intergenic
1147652338 17:42069675-42069697 CCAGACCAGGCCAGGCTGGCTGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148348086 17:46917461-46917483 CCACTCCTGGACATGCTGGGAGG + Intergenic
1149778536 17:59377858-59377880 TCACACCAGCACAGGCTTTCAGG - Intronic
1150209859 17:63436001-63436023 CCATACCTGAAGAGGCAGGCAGG + Intronic
1151670614 17:75569946-75569968 CAGCACCTGCGCAGGGTGGCAGG - Exonic
1152036319 17:77875250-77875272 CCACATTTGTACAGGCTGGAGGG - Intergenic
1152424240 17:80210362-80210384 CCACTACTCCCCAGGCTGGCCGG + Exonic
1152513479 17:80806126-80806148 CCACCCCTGCATAAGCTGACTGG - Intronic
1154161131 18:11981510-11981532 CCACACCTGCGCTGGCGGGAAGG - Exonic
1155018725 18:21874354-21874376 GCACCCCTTCACAGGGTGGCAGG + Intergenic
1155091319 18:22514641-22514663 ACACACCTGTACATGGTGGCTGG + Intergenic
1155413382 18:25570682-25570704 GCACATCTTCACAGGGTGGCAGG + Intergenic
1161364761 19:3872017-3872039 ACCAACCTCCACAGGCTGGCCGG + Intergenic
1162873036 19:13600188-13600210 ACACCCCAGCCCAGGCTGGCCGG + Intronic
1164597184 19:29537911-29537933 CCACAGCTGCCCATGCTGGTGGG + Intronic
1164649511 19:29881927-29881949 CCACAGTTGCCCAGGCTGGAGGG + Intergenic
1165075996 19:33280215-33280237 TCAGCCCTGCTCAGGCTGGCAGG + Intergenic
1165538314 19:36468881-36468903 CCACTCTTGCCCAGGCTGGAGGG - Intronic
1166124076 19:40703363-40703385 CCACACCTGCTCATGCTCCCTGG + Intronic
1166719986 19:44991140-44991162 CCACACCTGGTCTGGCAGGCCGG - Intronic
1166838903 19:45684221-45684243 CCACACCTGAGAAGGCAGGCAGG + Intergenic
925317559 2:2937566-2937588 CCACGACTGCACAGGCTGTGGGG - Intergenic
925406019 2:3605855-3605877 CCAGAGCTGCACAGCCTGGCAGG - Intronic
927301424 2:21520339-21520361 CCACACCAGCACTGGATGGTTGG - Intergenic
929562323 2:42963577-42963599 CCACACCTGTACTGGGTGTCAGG + Intergenic
930173797 2:48280397-48280419 CCATAGCCACACAGGCTGGCAGG - Intergenic
930853832 2:55990825-55990847 CCACAACTGCACAGGGAGGTGGG + Intergenic
933906731 2:86901401-86901423 CCACACAGGCACAGGCAGGAAGG + Intergenic
933920350 2:87039500-87039522 CGACACCTGAACAGGCTGTTGGG - Intergenic
933931274 2:87154286-87154308 CGACACCTGAACAGGCTGTTGGG + Intergenic
934002647 2:87730399-87730421 CGACACCTGAACAGGCTGTTGGG + Intergenic
934763218 2:96867569-96867591 CCACACCTGGGCAGGCAGTCTGG + Intronic
935775819 2:106470310-106470332 CCACACAGGCACAGGCAGGAAGG - Intergenic
936361847 2:111811145-111811167 CGACACCTGAACAGGCTGGTGGG - Intronic
936365431 2:111850270-111850292 CCACACAGGCACAGGCAGGAAGG - Intronic
937845708 2:126576693-126576715 GGACACCAGCACAGGCTTGCTGG - Intergenic
937957023 2:127427275-127427297 CCAAACCTGAACAGCCTGCCTGG - Intronic
938163841 2:129009406-129009428 CCACTCCTGCAGAGGCCGACTGG - Intergenic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
939113380 2:138033549-138033571 CCACCCTTGCAGATGCTGGCAGG + Intergenic
939162830 2:138609566-138609588 CAGCACCTGCACAGGTAGGCAGG + Intergenic
942595401 2:177587409-177587431 CCACACCTGTACAGCCAGGAAGG - Intergenic
943591493 2:189803019-189803041 CAATACTTGCACAGGCAGGCAGG + Intronic
945495131 2:210500031-210500053 GCACATCTTCACAGGGTGGCAGG + Intronic
945726422 2:213476249-213476271 CAACACCTGAACAGGCTGTCGGG + Intronic
946310449 2:218880182-218880204 ACACACCTGCAGGGGCTGGAGGG - Intergenic
947100691 2:226618175-226618197 TCACACAAGCACAGGCTGTCTGG + Intergenic
947107050 2:226678567-226678589 CCATATCTACACACGCTGGCTGG + Intergenic
947717621 2:232349824-232349846 CCACACCTGCAGAGTCGGGTCGG + Intergenic
948050848 2:234978343-234978365 CCACTGCTGTACAGGCTGTCAGG - Intronic
948637651 2:239349655-239349677 CACCACCTGCACACACTGGCTGG - Intronic
948804679 2:240448385-240448407 CTACACCTGGACTGCCTGGCAGG - Intronic
948953204 2:241268528-241268550 CCATACCAGCAAAAGCTGGCAGG - Exonic
1168811331 20:706540-706562 CTCCACCTGCACAGTCAGGCAGG + Intergenic
1171462681 20:25307660-25307682 CCACTCCTGAACAGGAAGGCAGG + Intronic
1171524178 20:25796650-25796672 CCACATCTGCTGAGGCAGGCAGG + Intronic
1171543978 20:25986987-25987009 CCACATCTGCTAAGGCAGGCAGG - Intergenic
1171552649 20:26059233-26059255 CCACATCTGCTGAGGCAGGCAGG - Intergenic
1171806730 20:29687841-29687863 CCACACCTGATGAGGCAGGCAGG - Intergenic
1172229681 20:33328317-33328339 CAACACCTGCAGGGGCAGGCGGG + Intergenic
1172610120 20:36244552-36244574 TCACTCCTGCAGAGCCTGGCAGG - Intronic
1174315650 20:49698737-49698759 CAACACAGGCACAGGGTGGCAGG - Intronic
1174315920 20:49701557-49701579 CAACACAGGCACAGGGTGGCAGG - Intronic
1175161588 20:57011840-57011862 ACACACACGCTCAGGCTGGCAGG - Intergenic
1175787102 20:61718567-61718589 CACCACCTGCACAGGCTCACAGG + Exonic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176679754 21:9813028-9813050 CCACATCTGGTCAGGCCGGCGGG + Intergenic
1176680038 21:9814437-9814459 CCACACGTGGTCAGGCCGGCAGG + Intergenic
1176680891 21:9818660-9818682 CCACACGTGGTCAGGCCGGCAGG + Intergenic
1176681457 21:9821486-9821508 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1176682019 21:9824304-9824326 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1176682302 21:9825705-9825727 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176682582 21:9827114-9827136 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176682861 21:9828533-9828555 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1176683140 21:9829930-9829952 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176683419 21:9831340-9831362 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176683700 21:9832749-9832771 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1176683978 21:9834152-9834174 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1176684257 21:9835561-9835583 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1176684537 21:9836962-9836984 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1176684817 21:9838364-9838386 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1177298053 21:19202538-19202560 ACACACCTGCTCAGGCTGGCAGG - Intergenic
1178490516 21:33048123-33048145 CCCCACCTGCAGAGGCAAGCAGG + Intergenic
1178976202 21:37223200-37223222 CCACTCTTGCCCAGGCTTGCTGG - Intergenic
1179017109 21:37603420-37603442 CAACCCCTGCCAAGGCTGGCAGG - Intergenic
1179537318 21:42060975-42060997 CCACACCAGCACAGGCCAGGAGG - Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1179873602 21:44256278-44256300 ACACACCTGCTGAGGCTGACTGG + Intronic
1180171153 21:46059025-46059047 CCACACATTCACAGGCTCACAGG + Intergenic
1180980813 22:19877229-19877251 CCACACCTGCACATGGGGGATGG + Exonic
1181349159 22:22243212-22243234 CCTCCTCTGCACAGGCTGGTGGG - Intergenic
1181910942 22:26237777-26237799 CCCCACCTTCACAGGCTTGGAGG - Intronic
1182797661 22:33003044-33003066 CCACCTCTTCACAGGGTGGCAGG - Intronic
1184278509 22:43424398-43424420 CTCCACCTGCTCAGGCTTGCAGG + Intronic
1184844227 22:47071296-47071318 CCACAGCAGCACAGGCTGTAAGG - Intronic
1185022116 22:48382744-48382766 CTACACCTGCGCAGGCAGGAGGG - Intergenic
950493912 3:13322401-13322423 CCAGGCCTGCACAGGCTGGCTGG + Intronic
951524438 3:23640176-23640198 CCACACCTGCCCAGAGTGGAGGG + Intergenic
952058106 3:29473779-29473801 CCACACTTGGAGGGGCTGGCCGG - Intronic
952141033 3:30479482-30479504 GCACCTCTTCACAGGCTGGCAGG - Intergenic
954414221 3:50385092-50385114 GCCCACCATCACAGGCTGGCAGG + Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954613739 3:51959201-51959223 CCACCCCTGCACAAGGAGGCAGG - Intronic
954716969 3:52531756-52531778 CCACACCTGCCCATGGTGCCAGG + Intronic
955062270 3:55503608-55503630 CAACACTTCCACAGGCTTGCAGG + Intergenic
955748128 3:62160324-62160346 GTACAAGTGCACAGGCTGGCAGG - Intronic
957053479 3:75427391-75427413 CACCACCTGCACAGGATGCCTGG + Intergenic
960101470 3:113747022-113747044 CCTCAGCTGCACAGGTTGGGGGG - Exonic
960313225 3:116142434-116142456 TTGCACCTGCACAGGCTGGATGG - Intronic
961778446 3:129306925-129306947 CCACACCTAGACAGGCAGGTGGG - Intergenic
965691962 3:171366931-171366953 CCACCTCTTCACAGGGTGGCAGG - Intronic
966762339 3:183428881-183428903 CCACACCTGCACTGGGAGCCCGG + Intergenic
968949914 4:3685179-3685201 CCACACCTGCACAGAGAGGCTGG - Intergenic
969241522 4:5901758-5901780 CCGAAGCAGCACAGGCTGGCAGG + Intronic
969676756 4:8618642-8618664 CCATTCCTCCCCAGGCTGGCTGG + Intronic
971535932 4:27751397-27751419 ACACCCCTTCACAGGGTGGCAGG - Intergenic
971710662 4:30106730-30106752 GCACTCCTTCACAGGGTGGCAGG + Intergenic
975000252 4:69216554-69216576 CCACACCAGCACATTCTCGCAGG + Intergenic
975013931 4:69387639-69387661 CCACACCAGCACATTCTCGCAGG - Intronic
975015185 4:69406990-69407012 CCACACCAGCACATTCTCGCAGG - Intronic
975044361 4:69783501-69783523 ACACACCTGCCCAAGGTGGCAGG - Intronic
975766705 4:77676187-77676209 CCTAACCTGCACAGTCTGGGGGG - Intergenic
976511235 4:85911285-85911307 CCAGAGCTGCACAAGCCGGCAGG - Intronic
979819894 4:125158161-125158183 CCTCACCTGCACAGCTTTGCAGG - Intergenic
983819025 4:172170359-172170381 CAACACCTTCACAAGGTGGCAGG - Intronic
984381474 4:178997952-178997974 CCACACCCACAAAGGCTGCCTGG - Intergenic
985667370 5:1188037-1188059 CCACAGCTGCTGAAGCTGGCGGG - Intergenic
985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG + Intergenic
985913067 5:2897872-2897894 CCACGGGTGCACAGGCCGGCAGG + Intergenic
986172169 5:5323993-5324015 CCACACATGCTCTGGCTGCCTGG + Intergenic
993517676 5:88857719-88857741 GCACCCCTTCACAGGGTGGCAGG - Intronic
994730090 5:103481590-103481612 CTCCACCTGCACTGGCAGGCAGG - Intergenic
995369403 5:111401949-111401971 CAACACCAGCACTGGCTGGCTGG - Intronic
995582622 5:113617399-113617421 CCACACTTGGAGTGGCTGGCTGG + Intergenic
997378758 5:133420509-133420531 TCACACCTGTGCAGGCTGGCTGG + Intronic
1001560409 5:172665471-172665493 CCACACCTGCACTGCCTGTCAGG - Intronic
1001587846 5:172845317-172845339 CCACAGATGCACAGGCTGGTAGG - Intronic
1002202682 5:177539112-177539134 GCAAGTCTGCACAGGCTGGCTGG + Exonic
1002300671 5:178255781-178255803 CACCACCTGCACAGCCAGGCGGG + Intronic
1002454884 5:179340233-179340255 CCACTGCTGCCCAGCCTGGCAGG + Intronic
1003128227 6:3373154-3373176 TCACACAGGCACAGGCTGCCTGG - Intronic
1003132066 6:3403329-3403351 CCACACCTGGACAGACAGGATGG - Intronic
1004793588 6:19056237-19056259 GCACATCTTCACAAGCTGGCAGG - Intergenic
1007088894 6:39169653-39169675 CCAGACCTGCACAGGAAGTCTGG - Intergenic
1014570848 6:123005751-123005773 CCACCCCTCCACAGTGTGGCAGG + Intronic
1016317325 6:142805253-142805275 CCTCTTGTGCACAGGCTGGCTGG - Intronic
1017809985 6:157977609-157977631 CCAGACCTGCACATGGTGGAAGG - Intergenic
1018335141 6:162778791-162778813 CCACACAGGCCCAGGCTTGCTGG - Intronic
1018834445 6:167472516-167472538 CCACAGCTCCACAGGCTGTGAGG + Intergenic
1019329506 7:455637-455659 TCACACGTGCACAGACGGGCTGG + Intergenic
1019742156 7:2680345-2680367 GCACACCTGCCCAGCCTGGCAGG - Intronic
1019894215 7:3971182-3971204 CCACACCTGCATGGGGTGGTCGG + Intronic
1019998325 7:4739725-4739747 CCACCCCTGCTCCGGCAGGCGGG - Intronic
1021500980 7:21330851-21330873 CCACACTTGCACGGCCAGGCAGG - Intergenic
1021977108 7:26021363-26021385 TCACACCTGAGCAGGCTGGGGGG + Intergenic
1022133265 7:27423662-27423684 ACACACTTGCACAGGCACGCTGG - Intergenic
1023253508 7:38290510-38290532 GCACACCTACAGAGACTGGCGGG + Intergenic
1024063270 7:45714291-45714313 CCAAACCTGAACAGGCTTGCTGG - Exonic
1024532116 7:50401908-50401930 CCACACATACATAGGATGGCTGG + Exonic
1025031196 7:55558480-55558502 GCACACCTGAACAGGTTAGCAGG - Intronic
1025295356 7:57772066-57772088 CCACATCTGCTAAGGCAGGCCGG - Intergenic
1025943134 7:66087867-66087889 CCACACCTCCACGGACAGGCTGG + Intronic
1026231638 7:68488973-68488995 CCACACCTGCACACGCTTCCTGG + Intergenic
1026879778 7:73901111-73901133 CCACGCCTTCAGAGGCTGGGAGG - Intergenic
1027991142 7:85361791-85361813 GCACCTCTTCACAGGCTGGCAGG - Intergenic
1029262150 7:99310192-99310214 GCACAAGGGCACAGGCTGGCTGG + Intergenic
1029804588 7:102983074-102983096 CCACACCTTCAAAGGCCTGCTGG + Intronic
1031750341 7:125563797-125563819 ACACACCAGCAGATGCTGGCAGG + Intergenic
1031850025 7:126852041-126852063 CCACATCTCCACTGGCTGGAGGG + Intronic
1032316326 7:130842102-130842124 AGGCACCTGCACACGCTGGCAGG - Intergenic
1032497605 7:132374463-132374485 CTACACCAGCAAAGGCTGGAGGG + Intronic
1032617463 7:133490038-133490060 CCACACCTTCACACACAGGCTGG - Intronic
1033277856 7:139986062-139986084 GCCCACCTAAACAGGCTGGCGGG + Intronic
1034274822 7:149819499-149819521 CCTCACCTGGGCAGGCTCGCAGG - Intergenic
1034698239 7:153074022-153074044 CCACACCTGCCCAGCAAGGCAGG - Intergenic
1035243970 7:157550514-157550536 CCCCACCTGCCCTGCCTGGCTGG + Intronic
1035459594 7:159030815-159030837 CCGCACCTGCCCAGGCTCACGGG - Intronic
1035790641 8:2301300-2301322 GCACATCTTCACAGGGTGGCAGG + Intergenic
1035802164 8:2420405-2420427 GCACATCTTCACAGGGTGGCAGG - Intergenic
1037649993 8:20827492-20827514 TCACACCACCCCAGGCTGGCTGG - Intergenic
1038771407 8:30485189-30485211 CCTAACTTGCACAGGCTGTCAGG - Intronic
1039583537 8:38686193-38686215 CCACCCCTGCAGAGGCATGCAGG + Intergenic
1040577599 8:48667424-48667446 GCACATCTTCACAGGGTGGCAGG + Intergenic
1041040736 8:53843444-53843466 TCCCACCTGCCCTGGCTGGCTGG - Intronic
1041241818 8:55854805-55854827 GTGCACCTGCACAGGCTGCCTGG + Intergenic
1041566110 8:59280731-59280753 CCACACCTGGAGAGGGTGGTTGG - Intergenic
1042512583 8:69626748-69626770 CCACACTCGCAGAGGCCGGCCGG - Intronic
1047482834 8:125301188-125301210 CCCCAGCAGCACAGGCTGGTGGG + Intronic
1048267683 8:133001845-133001867 CCACACCTGCACAGGCTGGCTGG - Intronic
1048372344 8:133790195-133790217 CCAAATCTGCACTTGCTGGCAGG - Intergenic
1049203073 8:141351239-141351261 GCAGACCTGGACAGGCTGGCAGG - Intergenic
1049320852 8:141995449-141995471 CCACTCAGGGACAGGCTGGCAGG - Intergenic
1049706744 8:144046569-144046591 CCACACCTCCACACACAGGCAGG - Intronic
1049756490 8:144313378-144313400 GTACGCCTGCACAGGCTGGAGGG - Intronic
1050399052 9:5231438-5231460 ACACACCAGCACAGTCTGGTAGG + Exonic
1053014589 9:34654663-34654685 CCACCCCTGCCCTGGCTGCCAGG - Intronic
1053208095 9:36205103-36205125 CCACAATAGCACTGGCTGGCTGG - Intronic
1053271375 9:36751953-36751975 CCACTCCTGCCCAGGCCGGAAGG - Intergenic
1054160086 9:61667456-61667478 CCACATCTGTTCAGGCCGGCAGG - Intergenic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054172749 9:61856223-61856245 CCACATCTGGAGAGGCCGGCAGG - Intergenic
1054447597 9:65385226-65385248 CCACATCTGGAGAGGCCGGCAGG - Intergenic
1054664791 9:67724578-67724600 CCACATCTGGAGAGGCCGGCAGG + Intergenic
1054738136 9:68777057-68777079 ACACACCTGCATGGGCTGGAGGG + Intronic
1057146080 9:92760351-92760373 CCACGCCTCCACATGCTGGCAGG + Intronic
1057294595 9:93827810-93827832 CCGCAGCTGCACCGGCTGCCTGG - Intergenic
1059562691 9:115350761-115350783 CCACCCATGCAAAGGATGGCTGG - Intronic
1061399418 9:130360254-130360276 CCACACCAGCAGAGTCTGACGGG + Intronic
1061906311 9:133701094-133701116 GCACCCCTGCACAGCCTGGCTGG - Intronic
1062344324 9:136107930-136107952 CCACCCCTGGACAGGTAGGCAGG + Intergenic
1203664919 Un_KI270754v1:15562-15584 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1203665206 Un_KI270754v1:16971-16993 CCACACGTGATCAGGCCGGCAGG + Intergenic
1203665764 Un_KI270754v1:19788-19810 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1203666344 Un_KI270754v1:22607-22629 CCACACGTGGTCAGGCCGGCAGG + Intergenic
1203666911 Un_KI270754v1:25426-25448 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1203667493 Un_KI270754v1:28246-28268 CCACACGTGGTCAGGCCGGCAGG + Intergenic
1203668060 Un_KI270754v1:31065-31087 CCACATCTGGTCAGGCCGGCAGG + Intergenic
1203668641 Un_KI270754v1:33885-33907 CCACACGTGGTCAGGCCGGCAGG + Intergenic
1203669487 Un_KI270754v1:38111-38133 CCACACGTGGTCAGGCCGGCAGG + Intergenic
1203669772 Un_KI270754v1:39518-39540 CCACATCTGCTCAGGCCGGCAGG + Intergenic
1185637098 X:1560734-1560756 GCACACCTTCACAAGGTGGCAGG - Intergenic
1186323564 X:8455133-8455155 CCAAACCTGCACTGGGTGGGAGG - Intergenic
1187299575 X:18034661-18034683 TCACTCATGCACAGTCTGGCTGG + Intergenic
1189322165 X:40093706-40093728 GCATACCTGTACATGCTGGCGGG + Intronic
1190107114 X:47568900-47568922 CCACCCCTCCCCAGGCTGGGAGG - Intronic
1193316401 X:80070915-80070937 GCACATCTTCACAGGGTGGCAGG + Intergenic
1193385897 X:80871433-80871455 ACCCACCTCCACAGGCTTGCAGG - Intergenic
1193468178 X:81871616-81871638 CAGCACCTGCACAGGTTGCCAGG - Intergenic
1194092702 X:89599216-89599238 ACACATCTTCACAGGGTGGCAGG + Intergenic
1194379834 X:93178302-93178324 TAACACCTGCACAGGTTGCCAGG + Intergenic
1199046843 X:143184446-143184468 CCACATCTTCACATGGTGGCAGG + Intergenic
1199974791 X:152887007-152887029 CCACAGCAGCAGGGGCTGGCAGG + Intergenic
1200071756 X:153532606-153532628 CCATCCCCGCACAGACTGGCCGG - Intronic
1200445347 Y:3255320-3255342 ACACATCTTCACAGGGTGGCAGG + Intergenic
1202381113 Y:24277030-24277052 CCAGGCCTGCAAAGGCTGACTGG - Intergenic
1202489672 Y:25393096-25393118 CCAGGCCTGCAAAGGCTGACTGG + Intergenic