ID: 1048269377

View in Genome Browser
Species Human (GRCh38)
Location 8:133016402-133016424
Sequence GCCAAAAATGTCTCCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048269371_1048269377 15 Left 1048269371 8:133016364-133016386 CCAGATGTCAGTGGCATCTCTCC 0: 1
1: 0
2: 1
3: 37
4: 312
Right 1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG No data
1048269373_1048269377 -7 Left 1048269373 8:133016386-133016408 CCTGACCCCTGTGACAGCCAAAA 0: 1
1: 0
2: 1
3: 17
4: 238
Right 1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG No data
1048269372_1048269377 -6 Left 1048269372 8:133016385-133016407 CCCTGACCCCTGTGACAGCCAAA 0: 1
1: 0
2: 2
3: 16
4: 245
Right 1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG No data
1048269367_1048269377 29 Left 1048269367 8:133016350-133016372 CCTTGTCTCTCCCACCAGATGTC 0: 1
1: 0
2: 0
3: 25
4: 459
Right 1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG No data
1048269366_1048269377 30 Left 1048269366 8:133016349-133016371 CCCTTGTCTCTCCCACCAGATGT 0: 1
1: 0
2: 2
3: 37
4: 425
Right 1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG No data
1048269369_1048269377 19 Left 1048269369 8:133016360-133016382 CCCACCAGATGTCAGTGGCATCT 0: 1
1: 0
2: 6
3: 99
4: 562
Right 1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG No data
1048269370_1048269377 18 Left 1048269370 8:133016361-133016383 CCACCAGATGTCAGTGGCATCTC 0: 1
1: 0
2: 6
3: 86
4: 516
Right 1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048269377 Original CRISPR GCCAAAAATGTCTCCAGATG TGG Intronic
No off target data available for this crispr