ID: 1048271041

View in Genome Browser
Species Human (GRCh38)
Location 8:133028230-133028252
Sequence CTCAGGTAACCCAGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048271041_1048271047 15 Left 1048271041 8:133028230-133028252 CCTGCTTTCCTGGGTTACCTGAG 0: 1
1: 0
2: 0
3: 24
4: 211
Right 1048271047 8:133028268-133028290 AACACATTCATCCTAACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048271041 Original CRISPR CTCAGGTAACCCAGGAAAGC AGG (reversed) Intronic
900514299 1:3073942-3073964 CGCAGGGAACCCAGGCAAGCGGG - Intronic
901489719 1:9590379-9590401 CTCAGCTAACCCAGGATGGGGGG + Intronic
901989048 1:13097662-13097684 GTGAGGTGACCCAGGAAGGCTGG - Intergenic
901992765 1:13129105-13129127 GTGAGGTGACCCAGGAAGGCTGG + Intergenic
902199276 1:14821775-14821797 CCCAGTCAACCCTGGAAAGCTGG + Intronic
902280512 1:15371047-15371069 CTCAGGGCAACCAGGAAGGCAGG + Intronic
903563447 1:24246327-24246349 CTCAGGAAACACAGGCAAGTGGG - Intergenic
904270212 1:29344889-29344911 CTCAGGTCACACAGGAAGGTAGG - Intergenic
904577634 1:31515141-31515163 CTCAGGAAAGACAGGAAACCAGG - Intergenic
905172805 1:36119032-36119054 CTCCCGTAACCCTGGAAGGCTGG + Intronic
906727805 1:48056397-48056419 CTCAGGCAAGCCAGGACAGATGG - Intergenic
909770454 1:79415009-79415031 CTCGTGATACCCAGGAAAGCAGG + Intergenic
912490532 1:110060368-110060390 TTCAGGGAACCCAGGAAAATGGG - Exonic
916625671 1:166552649-166552671 CTCCCCTAACCAAGGAAAGCTGG - Intergenic
916738320 1:167627880-167627902 CCCAGATAACCCAGCAAACCTGG + Intergenic
918237382 1:182593511-182593533 CTCATGTTACCCAGGAGAGGGGG + Intergenic
918967389 1:191369282-191369304 CACAGGGAACAAAGGAAAGCAGG - Intergenic
919739383 1:200973034-200973056 CTCAGGTAGCTAAGGAAACCAGG - Intronic
921240863 1:213180294-213180316 CTCAGTTAAACCAGGAAGTCTGG + Intronic
921749053 1:218771460-218771482 CAGAGGAAAGCCAGGAAAGCCGG + Intergenic
922885840 1:229019845-229019867 CTCAGATATCCCAAGAAGGCAGG - Intergenic
923148705 1:231215512-231215534 CTCAAATAACCCACAAAAGCAGG + Exonic
924838387 1:247678887-247678909 CTCAGGCAACCTGGGAAAGTTGG + Intergenic
1063047994 10:2413422-2413444 CTCTGGTAATGCAAGAAAGCGGG + Intergenic
1068024170 10:51622232-51622254 CTCAGGTCACCTGGAAAAGCTGG + Intronic
1068582327 10:58755830-58755852 CTCAGGTTGCTCAAGAAAGCAGG - Intronic
1069820417 10:71224124-71224146 CCCTGGCAGCCCAGGAAAGCCGG + Intronic
1070763627 10:79043978-79044000 CTCAGAGAACCCAGGAGAACTGG + Intergenic
1071093862 10:81950667-81950689 CTCAGATAACACAGAAATGCTGG - Intronic
1071701820 10:87946836-87946858 CTCAGGGTTCCCAGTAAAGCAGG + Intronic
1071713303 10:88070838-88070860 CTGAGATAAGCCAGGAAAGACGG - Intergenic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077660718 11:4066172-4066194 CAGAGCTAACCCAGGGAAGCTGG - Intronic
1079059895 11:17239411-17239433 CTCAGGTCACCAAGTAAACCTGG - Intronic
1080042049 11:27769332-27769354 ATCAGCTAACCCAGCAAAACTGG + Intergenic
1080367088 11:31587213-31587235 CTAAGGTAACTCAAGAAAGGTGG + Intronic
1080642471 11:34165884-34165906 AGCAGGTACCCCAGGAAGGCAGG + Intronic
1080731819 11:34964033-34964055 CTCAGGGAACCCAGTAGAGAAGG + Intronic
1081000216 11:37660359-37660381 ACCTGGAAACCCAGGAAAGCAGG + Intergenic
1081734306 11:45392511-45392533 CAGAGGTAACCCCAGAAAGCTGG - Intergenic
1084043425 11:66555607-66555629 CCCAGGTAACCCAGGTAACTGGG - Intronic
1086498834 11:87431555-87431577 CTCAAGTCACCCAGGGAAACTGG - Intergenic
1087083458 11:94194136-94194158 CTCAGGTCACGCAGGTCAGCGGG - Intergenic
1087137927 11:94739427-94739449 CTTAGGGAGCCCAGGGAAGCAGG - Intronic
1088446786 11:109939286-109939308 TTCAGGTAACAGTGGAAAGCTGG + Intergenic
1091230995 11:133988080-133988102 CTCAGGTAAACCAGAACAGCTGG + Intergenic
1091456055 12:608860-608882 CTCAGGTCACACAGGCTAGCTGG - Intronic
1091792572 12:3280295-3280317 CTCAGGTCACCCAGGATGGTGGG - Intronic
1092977039 12:13755536-13755558 ATCATGTAATTCAGGAAAGCAGG + Intronic
1095961333 12:47836014-47836036 CTCAGGTACCACAGGAATGCGGG - Intergenic
1100957055 12:99920621-99920643 AGCAGGGTACCCAGGAAAGCCGG + Intronic
1101888780 12:108692536-108692558 CTCAAGTAGCCCATGAAAGAAGG + Intronic
1103674201 12:122642935-122642957 CTCACAGAACCCAGGAAAACAGG + Intergenic
1105473811 13:20714428-20714450 CTGGGCTAACCCAGGAGAGCTGG + Intronic
1105571868 13:21610785-21610807 CTCAGGCACCCCAGGAAGCCAGG - Intergenic
1110102981 13:71633013-71633035 ATCAGGTAACCAAGGAAAAATGG - Intronic
1112975185 13:105308964-105308986 CTCAGGTGAAACAGGAAGGCTGG - Intergenic
1113743758 13:112728472-112728494 TACAGGTAACACAGGGAAGCGGG - Intronic
1115698486 14:35925161-35925183 CTCCAGTAACCCAGTAAACCTGG + Intronic
1117464186 14:55975836-55975858 CTCAACAAACTCAGGAAAGCTGG - Intergenic
1119945659 14:78691088-78691110 GTCAGGAAACCCAGGAAAAGAGG + Intronic
1120701627 14:87704880-87704902 ATCAGGTAACCCTAGAAGGCTGG - Intergenic
1121123093 14:91388513-91388535 CTCAGGTCACTCAGGAAAAGAGG - Intronic
1121583272 14:95046214-95046236 CGCAGAAAACCCAGAAAAGCTGG - Intergenic
1124404213 15:29379643-29379665 CCCAGGGAAGCCAGGGAAGCAGG - Intronic
1125268557 15:37913032-37913054 CTCAGGTAGCCCAGGTATGCTGG - Intergenic
1125501675 15:40243668-40243690 CTCAGAATGCCCAGGAAAGCTGG + Intronic
1125519499 15:40340119-40340141 CTAAGGTCACCCAGGAAGGAAGG + Intronic
1126075118 15:44901529-44901551 CTCAGGTACCCTAGGAAATTTGG - Intergenic
1126083245 15:44986279-44986301 CTCAGGTACCCTAGGAAATTTGG + Intergenic
1126228961 15:46303332-46303354 TTCGGGTAACAAAGGAAAGCAGG + Intergenic
1127276176 15:57446333-57446355 CACAGGAAACCCAGGAAACCTGG - Intronic
1127676845 15:61247527-61247549 CTCACCTAACTCAAGAAAGCAGG + Intergenic
1128294409 15:66505499-66505521 CTCCTGGACCCCAGGAAAGCTGG - Intronic
1128310699 15:66630365-66630387 CCCAGGTAAACCAGGATAGTTGG - Intronic
1128970756 15:72102828-72102850 CTCAGGCAGCAAAGGAAAGCAGG + Intronic
1128995765 15:72293248-72293270 CTCAGGTGACCCAGAAATGGTGG + Intronic
1130369491 15:83272674-83272696 CTCACGCAACCCAGGAAACCAGG + Intronic
1131975614 15:97943080-97943102 TTCTGGAAACCCAGGAAAACTGG + Intergenic
1131992181 15:98103192-98103214 CCCAGGCAAACCAGGACAGCTGG + Intergenic
1133042090 16:3066196-3066218 CGGAGGGAACCCAGGAAAGGAGG - Intronic
1133071052 16:3246977-3246999 CACAGGGGACCCAAGAAAGCCGG + Intronic
1133387041 16:5378212-5378234 CTCAGATAATCCAGAACAGCTGG - Intergenic
1134813237 16:17185157-17185179 CTCAGGAGACCCAGGACAACTGG + Intronic
1139478559 16:67215687-67215709 CTCATGGAACCCAGCAAAGATGG - Intronic
1139804538 16:69553000-69553022 CACAGTTAAATCAGGAAAGCAGG + Intergenic
1142985192 17:3691081-3691103 TTCAGGTAACGCTGGAAAGGTGG - Intronic
1145237967 17:21222395-21222417 CCCAGGCAAGCCAGGACAGCTGG - Intergenic
1147663979 17:42133952-42133974 CTCAGGTATCTCTGGAAGGCAGG - Intronic
1147973047 17:44230152-44230174 CTCAGGTCACGCAGGGAGGCAGG - Intergenic
1149061921 17:52432875-52432897 TTCAAGAAACCCAGGAAAGAAGG + Intergenic
1149417674 17:56477334-56477356 CTCAGGTATACCATGAATGCTGG - Intronic
1149927366 17:60714855-60714877 CTCAGGAAAGCTAGGAAAGCTGG - Intronic
1151572858 17:74935936-74935958 CTCAGGTAAGCCCGGAGCGCCGG + Intronic
1152228087 17:79101909-79101931 CCCAGGCACCCCAGGACAGCTGG + Intronic
1152344452 17:79742741-79742763 CTCAGGTACCCCAGGGAGGCAGG - Intergenic
1153814763 18:8782939-8782961 CTCAGGTACCTTAGGAAACCAGG + Intronic
1155077169 18:22369195-22369217 CCCAGGTAACCTAGGAGAGTTGG - Intergenic
1156857575 18:41800177-41800199 CTCTTGCATCCCAGGAAAGCTGG - Intergenic
1160156803 18:76441086-76441108 CTCAGGTAACCCTGGGACTCAGG - Intronic
1163036785 19:14574266-14574288 CACAGGTAGCCCTGGAAAGAAGG - Intergenic
1163396252 19:17063760-17063782 CTCAGCTCAACCAGGCAAGCAGG - Intronic
1165342155 19:35220547-35220569 TTCAGATAACTCAGGAATGCAGG - Intergenic
926414948 2:12640417-12640439 CTTAGGTCACCCAGTAAATCTGG - Intergenic
926711308 2:15883902-15883924 CTCAGGTAAACCAGGATGGTTGG - Intergenic
926731729 2:16040687-16040709 CTCAGGAGACCCAGGAGAGGTGG + Intergenic
929465327 2:42138759-42138781 CTCAAGTAATCCAGAAAAGGAGG + Intergenic
929541910 2:42829212-42829234 CACAGATAAGCCAGGAGAGCAGG + Intergenic
930324446 2:49897705-49897727 ATCTGGAGACCCAGGAAAGCTGG + Intergenic
931570961 2:63668694-63668716 TTCAGTTTACCCTGGAAAGCGGG - Intronic
932480472 2:72036132-72036154 GTCAGGCAACCCAGGAAGGACGG + Intergenic
933110050 2:78386567-78386589 CTCAGGTAAACTAGTAAAGAGGG - Intergenic
933872162 2:86577202-86577224 AACTGGAAACCCAGGAAAGCTGG - Intronic
936627555 2:114164494-114164516 AGCTGGAAACCCAGGAAAGCTGG - Intergenic
938910605 2:135882250-135882272 AGCTGGAAACCCAGGAAAGCTGG - Intergenic
940383413 2:153042836-153042858 CTCAGGTAAGCCTAGAGAGCTGG + Intergenic
941590618 2:167416237-167416259 CTGAGGTAACCCTGGGCAGCAGG - Intergenic
947680588 2:232028484-232028506 CCCAGGAAACCAAGGAAAGCAGG - Intronic
948088047 2:235267077-235267099 CTCAGGGAAGCCAGGAGAACGGG - Intergenic
948129329 2:235588897-235588919 CTCAAATAAGCCAGGAAAGCAGG - Intronic
1169736746 20:8845971-8845993 ATCAGGAAACCCAGCAAAACTGG + Intronic
1169928437 20:10807190-10807212 CTCAGGTTACCCTGGAGATCAGG + Intergenic
1170004346 20:11648777-11648799 CACAGGTAAACCAGGAAAGGAGG - Intergenic
1171370483 20:24659037-24659059 CCTGGGTAACCCAGGAAAGGAGG - Intronic
1171976420 20:31597518-31597540 CTAAGGTGACTCAGGAAAGGAGG + Intergenic
1172425359 20:34852118-34852140 CTCAGGGTCCCCAGGAAAGCAGG + Intronic
1172443694 20:34982180-34982202 CTCAGAAAACCCTGGAAGGCAGG - Intronic
1173360837 20:42343085-42343107 CTCAAGCAACCTAAGAAAGCAGG + Intronic
1174537222 20:51260594-51260616 CATAGGTAATCCAGGGAAGCGGG - Intergenic
1175324355 20:58112344-58112366 CTCAGGAAAACCAGAATAGCTGG + Intergenic
1178339682 21:31775356-31775378 TTCAGAGAACCTAGGAAAGCTGG + Intergenic
1179340459 21:40503435-40503457 CTCTGATAATGCAGGAAAGCTGG - Intronic
1182232138 22:28846391-28846413 CTCAGGAAAGCCAGGGAAGGTGG + Intergenic
1183062103 22:35342520-35342542 CTCAGCAACCCCAGGATAGCAGG - Intronic
1183523612 22:38310784-38310806 CTCGGGTGATCCTGGAAAGCAGG + Intronic
1183781720 22:40003205-40003227 GGCAGGTAACACAGGGAAGCTGG + Intronic
949303440 3:2611597-2611619 AGCAGGTAACCCAGGAAAAAAGG - Intronic
949512626 3:4780063-4780085 CTAAGGTAACACAGCAAAACAGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
949951216 3:9230343-9230365 GTCAGGAAACCAAGGAAGGCAGG - Intronic
950074968 3:10180752-10180774 CTGAGATAAACCAGGAGAGCAGG + Intronic
950624112 3:14231685-14231707 ATCAGGGAAACCAGGGAAGCTGG - Intergenic
954380277 3:50215578-50215600 CTTTGGGACCCCAGGAAAGCTGG + Exonic
954710072 3:52501281-52501303 ATCAGATAACCCAGGACTGCCGG + Exonic
955627440 3:60933549-60933571 CTCAGGTAAGCCTCAAAAGCGGG + Intronic
955866539 3:63390328-63390350 GGCAGGGAACCCAGGAAAGGAGG + Intronic
956740517 3:72272141-72272163 CTCAGGAAAACCAGGACAGTTGG - Intergenic
962196288 3:133366476-133366498 GTCACGGAACCCAAGAAAGCTGG - Intronic
965645433 3:170875559-170875581 CTCAGGTAACAGAAGAAACCAGG - Intergenic
965970448 3:174548745-174548767 CTCAGGTAACTGAAGAAAGGAGG - Intronic
966000780 3:174945520-174945542 CTCAGGGAATCCAGGAAATTTGG - Intronic
967386880 3:188920667-188920689 CCCAGGTCACCTAGCAAAGCTGG + Intergenic
967789358 3:193530715-193530737 CTCAGGCAAACCAGGACAGCTGG - Intronic
969244033 4:5921038-5921060 CTCAGGTCACTCAGATAAGCAGG - Intronic
969414260 4:7048371-7048393 CTCAGGTAAACCAGGCATCCTGG - Intronic
970989470 4:22195713-22195735 CAAAGGGAACCCAGGAAAGAAGG - Intergenic
973207342 4:47575407-47575429 CTCAGGAAAACCAGGATAGTTGG - Intronic
976772906 4:88673924-88673946 CTCAGGTGAGCCAGCAAGGCAGG - Intronic
981076971 4:140601943-140601965 CACAGGGAACAAAGGAAAGCAGG + Intergenic
983190178 4:164746705-164746727 CCCAGGCAAACCAGGAGAGCTGG + Intergenic
984669817 4:182469917-182469939 CTCAGATATCCCAGGACATCTGG + Intronic
984726802 4:183029433-183029455 CTCTTGAAACACAGGAAAGCTGG - Intergenic
986830025 5:11566646-11566668 CTTCGGTAACACAGGAAAGTGGG - Intronic
989341498 5:40380309-40380331 CACTGGTAGCCCTGGAAAGCTGG + Intergenic
989662811 5:43817441-43817463 CTCAGGTTTCCCAGGAACACTGG + Intergenic
990665536 5:58068193-58068215 CTAAGGTAAGCCAGGAAAGTTGG - Intergenic
992095844 5:73361746-73361768 CTCAGGCAAACCAGGATAGTTGG + Intergenic
992199169 5:74367357-74367379 CTCCTGTATCCCAGGAATGCAGG - Intergenic
992561587 5:77958005-77958027 CTCCGGGAGCCCAGGAACGCTGG - Intergenic
992948359 5:81832125-81832147 AGCTGGAAACCCAGGAAAGCTGG + Intergenic
993433205 5:87857687-87857709 CTCAAGTGACCCAGAATAGCCGG + Intergenic
993884696 5:93401899-93401921 CTCAAGTGACCCAGAAATGCAGG - Intergenic
994225403 5:97246366-97246388 CTGATGTAACCAAGGAAAGCTGG - Intergenic
996520866 5:124423969-124423991 CTGATGTCACCCAGGAAAACAGG + Intergenic
997829873 5:137140562-137140584 CCCAGGTAAGGCAGGAAGGCCGG - Exonic
999318725 5:150600473-150600495 CTCAGGTCACACAGCAAATCCGG - Intergenic
1002457155 5:179351685-179351707 CTCAGCAACCCCAGGAAACCAGG - Intergenic
1002882929 6:1268787-1268809 CTCAAGTAACCCAGAAGAGATGG + Intergenic
1005208347 6:23431147-23431169 CTCAGGTTACCCACAAAGGCAGG - Intergenic
1005230106 6:23690167-23690189 CTCAAATAACCCAGGTAAGCTGG - Intergenic
1006051677 6:31350189-31350211 CTCAGGCCACCAAGGGAAGCAGG - Intronic
1014003240 6:116388181-116388203 CTCTGGAGACCCAGGAAAACAGG + Intronic
1014483409 6:121967481-121967503 CTCAAAAAACCCAGGAAATCTGG + Intergenic
1015695539 6:135976015-135976037 CTCAGGGAACCCAGAAATGGTGG + Intronic
1019379058 7:712032-712054 CGCAGGTAAACAAGGGAAGCTGG + Intronic
1022330135 7:29370877-29370899 CTTAGCAAATCCAGGAAAGCAGG + Intronic
1022666678 7:32417202-32417224 CTCAGGGCACCCAGAAAAGCTGG + Intergenic
1022941262 7:35242124-35242146 CCCAGGTTAGCCAAGAAAGCTGG - Intronic
1023473153 7:40547128-40547150 AGCAGGAAAGCCAGGAAAGCTGG + Intronic
1023598097 7:41853682-41853704 CTCAGGTGTCCCAGGGAAGCAGG - Intergenic
1024548492 7:50541247-50541269 CTGGGGTAACCCAGCAAATCAGG - Intronic
1024939628 7:54748229-54748251 CTCAGGCAACCAAGCAGAGCAGG - Intergenic
1027358276 7:77381623-77381645 CTGAGGGAACCCAGGGAAGCAGG - Intronic
1029870928 7:103692155-103692177 CTCAGACAACCTAGAAAAGCTGG - Intronic
1030322551 7:108184399-108184421 CTCAGGTAAAGCGGGAAAGCGGG - Exonic
1032706142 7:134422697-134422719 CTGAGGTCACCCAGGAGGGCAGG - Intergenic
1032856366 7:135836950-135836972 ATCTGGAGACCCAGGAAAGCTGG + Intergenic
1033520517 7:142155746-142155768 CTCAGATAACCCAGGAAGCTAGG + Intronic
1035745727 8:1961072-1961094 CCCAGGTGACCTAGGAATGCAGG + Intergenic
1037748515 8:21664839-21664861 CCCAGGTAACAGTGGAAAGCTGG + Intergenic
1037998019 8:23367694-23367716 CTCAGGAAAACCAGGACAGTTGG - Intronic
1038295481 8:26288015-26288037 CTCAGGTAACCCAGGTAGCTGGG + Intergenic
1038329135 8:26593793-26593815 CTCAGGGAAACCAGCACAGCAGG - Intronic
1039819916 8:41126305-41126327 CACAGGTCACCCAGGACAGTTGG + Intergenic
1039836205 8:41258348-41258370 CTCAGGCACTCCAGGGAAGCGGG + Intergenic
1041696919 8:60745364-60745386 CTCTTAAAACCCAGGAAAGCTGG - Intronic
1042112316 8:65393849-65393871 GCCAGAGAACCCAGGAAAGCTGG + Intergenic
1044091267 8:88004940-88004962 CTCAGCTAACCTAAGAGAGCAGG - Intergenic
1045003315 8:97896717-97896739 ATCAGGTAACACAGCAAGGCTGG + Intronic
1045003341 8:97896841-97896863 ATCAGGTAACACAGCAAGGCTGG + Intronic
1047478520 8:125258469-125258491 CTCAGGGGAGCCAGGAAAGTGGG - Intronic
1048147975 8:131864080-131864102 CTCAGTTAAACCAGGAAGACAGG + Intergenic
1048271041 8:133028230-133028252 CTCAGGTAACCCAGGAAAGCAGG - Intronic
1048583988 8:135755785-135755807 CTCAGGTTACCCAGAGAAGCAGG - Intergenic
1049006747 8:139860553-139860575 CTCAGGTAATCCAACAAACCAGG + Intronic
1049740457 8:144238581-144238603 CTAAGATCACCCAAGAAAGCAGG - Intronic
1049976755 9:867347-867369 CTCTGGGAAGCCAGGAGAGCGGG + Intronic
1050036823 9:1445108-1445130 CCCAGGTAGCCTAGGAAAACAGG - Intergenic
1050338714 9:4614642-4614664 CCCAGGTAAACCAAGACAGCTGG - Intronic
1057147359 9:92767383-92767405 CCCAGGTAAGCCAGGAAGGTTGG - Intergenic
1060359529 9:122941398-122941420 CTCTGGTCCCCCAGCAAAGCCGG + Intronic
1061071097 9:128311182-128311204 GTCAGGAAACCCAGGCAAGCTGG + Intronic
1061108103 9:128547887-128547909 AGCTGGAAACCCAGGAAAGCTGG + Intergenic
1061290634 9:129648814-129648836 CTCTGGGAACCCAGGAATCCAGG - Intergenic
1187301131 X:18050850-18050872 CTCAGGAATCCCAGGCATGCAGG - Intergenic
1188000211 X:24973567-24973589 CTCAGGTAACCCTGGGAAGAGGG - Intronic
1188446315 X:30256561-30256583 TTCAGGTGACCCAGGAAACCAGG - Intergenic
1188562297 X:31482937-31482959 CTCAGGAAAACGAGGAAAGTTGG + Intronic
1193968506 X:88020361-88020383 CTCAGGTGAGCCAGGAAAAATGG - Intergenic
1196647055 X:118129022-118129044 CTCCAGTCACCCGGGAAAGCAGG + Intergenic
1197386385 X:125808556-125808578 CTCAGGCAAGCCTGTAAAGCTGG - Intergenic
1197875182 X:131095349-131095371 CTCAGGTGAGACAGGAAGGCTGG + Intergenic
1198431763 X:136574462-136574484 CCCAGGCAAACCAGGACAGCTGG + Intergenic
1200064414 X:153497684-153497706 CCCAGGGAACCCTGGGAAGCTGG - Intronic
1200126082 X:153815737-153815759 CCCAGGGAACCCTGGGAAGCTGG + Intronic
1200757003 Y:6999540-6999562 CTCAGGTAGGCTTGGAAAGCAGG - Intronic