ID: 1048274083

View in Genome Browser
Species Human (GRCh38)
Location 8:133052804-133052826
Sequence GTATGATTTGTTTGGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048274073_1048274083 15 Left 1048274073 8:133052766-133052788 CCCCAGCAAGGTGCTGTACCAGC 0: 1
1: 0
2: 1
3: 15
4: 133
Right 1048274083 8:133052804-133052826 GTATGATTTGTTTGGCTTCCTGG No data
1048274074_1048274083 14 Left 1048274074 8:133052767-133052789 CCCAGCAAGGTGCTGTACCAGCA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1048274083 8:133052804-133052826 GTATGATTTGTTTGGCTTCCTGG No data
1048274081_1048274083 -3 Left 1048274081 8:133052784-133052806 CCAGCAAGGGGGTCTCAGGCGTA 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1048274083 8:133052804-133052826 GTATGATTTGTTTGGCTTCCTGG No data
1048274075_1048274083 13 Left 1048274075 8:133052768-133052790 CCAGCAAGGTGCTGTACCAGCAA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1048274083 8:133052804-133052826 GTATGATTTGTTTGGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048274083 Original CRISPR GTATGATTTGTTTGGCTTCC TGG Intronic
No off target data available for this crispr