ID: 1048277669

View in Genome Browser
Species Human (GRCh38)
Location 8:133079229-133079251
Sequence CTTCCTACACAGATGGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048277669_1048277676 26 Left 1048277669 8:133079229-133079251 CCCAGTACCATCTGTGTAGGAAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1048277676 8:133079278-133079300 ATTAATTAGAATTAACTACTGGG No data
1048277669_1048277673 -5 Left 1048277669 8:133079229-133079251 CCCAGTACCATCTGTGTAGGAAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1048277673 8:133079247-133079269 GGAAGCAGCTGATTTCCAGAGGG No data
1048277669_1048277672 -6 Left 1048277669 8:133079229-133079251 CCCAGTACCATCTGTGTAGGAAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1048277672 8:133079246-133079268 AGGAAGCAGCTGATTTCCAGAGG No data
1048277669_1048277677 27 Left 1048277669 8:133079229-133079251 CCCAGTACCATCTGTGTAGGAAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1048277677 8:133079279-133079301 TTAATTAGAATTAACTACTGGGG No data
1048277669_1048277675 25 Left 1048277669 8:133079229-133079251 CCCAGTACCATCTGTGTAGGAAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1048277675 8:133079277-133079299 AATTAATTAGAATTAACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048277669 Original CRISPR CTTCCTACACAGATGGTACT GGG (reversed) Intronic
900913439 1:5618121-5618143 CTTCCTACTTAGATGGCACCAGG - Intergenic
913245149 1:116864437-116864459 GGTCCTACACAGATGGGACATGG - Intergenic
917625364 1:176840540-176840562 CTGCCTACAGAGATGTTTCTTGG - Intronic
918347141 1:183615982-183616004 GGTCCTACACAGATGGGACGTGG - Intergenic
918567648 1:185951675-185951697 GGTCCTACACAGATGGGACGTGG + Intronic
918714381 1:187768872-187768894 GGTCCTACACAGATGGGACGCGG + Intergenic
921829540 1:219711660-219711682 CTTCTTAATCAGATTGTACTGGG - Intronic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1064704184 10:18054422-18054444 CTTCCAAAACAGAAAGTACTGGG + Intergenic
1065617178 10:27539825-27539847 CTTCCTACACAAATGCATCTAGG - Exonic
1067177588 10:43960888-43960910 CTCCAAACACAGATGGTCCTGGG + Intergenic
1069156356 10:65035301-65035323 CTTCTTCTACAGTTGGTACTAGG - Intergenic
1071760390 10:88598186-88598208 CTTCCTCCACAGATCTTGCTAGG - Intronic
1076138444 10:128061002-128061024 CTTCCTACATAGATGTAAGTGGG + Exonic
1076366200 10:129922375-129922397 CTTCCCACACAGTGGGCACTGGG - Intronic
1080014499 11:27490414-27490436 TGTCCTCCACAAATGGTACTTGG + Intergenic
1084359231 11:68658882-68658904 ATTCATACACAGAAGGGACTGGG - Intergenic
1086319625 11:85630982-85631004 CTTCCACCACAGGTGGTAATAGG + Intronic
1091194889 11:133722086-133722108 CTTCAAACACAGCTGGTTCTAGG - Intergenic
1092626725 12:10336306-10336328 TGTCCTACACAGATGGGACGTGG + Intergenic
1093109413 12:15131541-15131563 TTTCCTACACTTATGTTACTAGG + Intronic
1097848838 12:64391572-64391594 CTTCCTGCATAGATTGTCCTGGG - Intergenic
1097858688 12:64495099-64495121 CTGCCTACACAGTTGATATTTGG + Intronic
1098173618 12:67770025-67770047 GGTCCTACACAGATGGGACACGG + Intergenic
1100402309 12:94242876-94242898 CCTCCCAGACAGCTGGTACTAGG + Intronic
1104165780 12:126228354-126228376 CATCCTAAAGTGATGGTACTTGG - Intergenic
1116752308 14:48901907-48901929 TTTCCTACACAGTTTGTATTAGG + Intergenic
1119828732 14:77681644-77681666 CTGCTTACAAAGATGGTCCTTGG + Intronic
1120296892 14:82652984-82653006 CTACCTTCACAGATGCTACAGGG - Intergenic
1120460035 14:84783609-84783631 ATTCCTATATAGATGGTAGTTGG + Intergenic
1121485400 14:94310626-94310648 CTACCTTCACAGATGGGACTTGG + Intronic
1123720571 15:23057963-23057985 CTTGCTCCACAGAAGTTACTGGG + Intergenic
1126461160 15:48916590-48916612 CTTCCTACACAGAATGGAATGGG + Intronic
1126883496 15:53124388-53124410 CTTCCTAAGCAGATAGTTCTGGG + Intergenic
1129204143 15:74025409-74025431 CTTTCCCCACAGATGGTTCTTGG + Intronic
1135467805 16:22702142-22702164 CTTCCCACACAGTCAGTACTGGG - Intergenic
1137477994 16:48827385-48827407 CTTCCTTCCCAGATGATCCTTGG - Intergenic
1143187828 17:5021133-5021155 ATACCAACACAGGTGGTACTTGG - Intronic
1148116171 17:45176393-45176415 CCTCCCACACAGCTGGCACTTGG - Intergenic
1148405380 17:47409161-47409183 CTTCCTACAGAGATGCAAGTTGG - Intronic
1150191900 17:63251139-63251161 CTTCCTTCACTGATTGTAGTAGG - Intronic
1151439698 17:74120189-74120211 GTTCCTAGGCAGATGGCACTTGG - Intergenic
1156881073 18:42080154-42080176 CTTCCTAAAGAAATGGTACTCGG - Intronic
1160239042 18:77109614-77109636 CTTCCTAGATAGTTGGCACTTGG + Intronic
1164818152 19:31222673-31222695 CTTCCTTCATAGGAGGTACTCGG + Intergenic
1164908328 19:31985535-31985557 CATCAGACACAGATGGTAATGGG + Intergenic
1165214552 19:34261112-34261134 TCTTCTACTCAGATGGTACTGGG - Intronic
1165510299 19:36262857-36262879 GTTCCTGCACAGATGGGACATGG + Intergenic
925544574 2:5003316-5003338 GTTCCCACACAGATGGGACACGG - Intergenic
925783968 2:7410374-7410396 TCTCCTACACAGTTGGTATTTGG + Intergenic
925828797 2:7876035-7876057 GGTCCCACACAGATGGGACTCGG + Intergenic
926464071 2:13167364-13167386 GGTCCTACACAGATGGGACGTGG + Intergenic
926874328 2:17457957-17457979 CTTCCTACAGAGTGGCTACTTGG + Intergenic
928158665 2:28900512-28900534 TTTCCTGCTGAGATGGTACTAGG + Intronic
929876859 2:45804040-45804062 CTTACTAGACAGAGGGTCCTGGG + Intronic
932295875 2:70622964-70622986 GGTCCTACACAGATGGGACGTGG - Intronic
932854189 2:75217166-75217188 GGTCCTACACAGATGGGACGCGG + Intergenic
933329499 2:80877840-80877862 GGTCCTACACAGATGGGACGTGG + Intergenic
934072333 2:88395973-88395995 CTCCCTTAACAGATGGTCCTGGG - Intergenic
935573108 2:104683188-104683210 CTTCCTCCACAGTTGCTGCTTGG - Intergenic
935917094 2:107966630-107966652 CTTCCAACACATGTGTTACTTGG - Intergenic
937888615 2:126917557-126917579 CTTGCTGCACAGCTGTTACTGGG - Intergenic
938899141 2:135784431-135784453 TTTTCTACATAGATAGTACTAGG + Exonic
940726418 2:157341478-157341500 GTTCCCACACAGATGGGACATGG + Intergenic
942333656 2:174856577-174856599 CTCCCTTCACAGCTGGTGCTTGG - Intronic
943835423 2:192509817-192509839 GGTCCTACACAGATGGGACATGG - Intergenic
946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG + Intergenic
947570228 2:231228019-231228041 CTTCCTCCACATACTGTACTGGG - Intronic
1175765073 20:61586898-61586920 CTTAGTACACAGTAGGTACTCGG - Intronic
1177119590 21:17123830-17123852 CATCCCACACAGATGGGACATGG - Intergenic
1184211390 22:43037694-43037716 TTTTCAACACAAATGGTACTTGG - Intergenic
949162074 3:894042-894064 GTTCCTGCACAGATGGGACGCGG + Intergenic
949190378 3:1243185-1243207 GTTCCTGCACAGATGGGACGCGG + Intronic
950007249 3:9699231-9699253 CTTCCTTCAGAGATGGCTCTTGG - Intronic
951051587 3:18099762-18099784 CTTCCTACACACAGGAAACTTGG - Intronic
954011848 3:47647522-47647544 TTTGCTATACAGATGGTTCTTGG - Intronic
958443788 3:94190126-94190148 CTTCCAACACAGATAGCACCTGG - Intergenic
958495003 3:94833721-94833743 CTTCCTATTCAAATGGTGCTGGG + Intergenic
962387328 3:134942493-134942515 CTTCCTAGTCATCTGGTACTGGG + Intronic
963557483 3:146811142-146811164 CTTCTTATCCAGATGGCACTTGG - Intergenic
963955696 3:151251236-151251258 CTTTCTACCCAGATGCTTCTTGG + Intronic
964300233 3:155278556-155278578 GGTCCTACACAGATGGGACATGG + Intergenic
966105067 3:176324997-176325019 AGTCCTACACAGATGGGACACGG + Intergenic
966232828 3:177669213-177669235 GGTCCTACACAGATGGGACGCGG + Intergenic
975525767 4:75348961-75348983 CTTCATACATAGATGGTTCATGG - Intergenic
977075185 4:92442339-92442361 GGTCCTACACAGATGGGACACGG + Intronic
981672671 4:147305121-147305143 TTTCCTAAACAGATGGAAATGGG - Intergenic
983805770 4:171989408-171989430 GTTCCTACACAGATGGGATACGG + Intronic
985052154 4:186001641-186001663 CATCATACACAGAAGGTGCTGGG + Intergenic
985319684 4:188696726-188696748 CTTCCTACATAGGTGCTATTTGG - Intergenic
990431400 5:55738343-55738365 ATTTGTACACAAATGGTACTCGG - Intronic
992006423 5:72482862-72482884 CTTTCTACACATGTGATACTTGG - Intronic
994324895 5:98436899-98436921 GGTCCTGCACAGATGGAACTTGG - Intergenic
994935752 5:106251255-106251277 CTTCTTACACATAAGGTACCTGG - Intergenic
996860169 5:128056297-128056319 CTTCCTACACAGAGGTTCCATGG - Intergenic
997772624 5:136568725-136568747 GGTCCTACACAGATGGGACGTGG + Intergenic
998996380 5:147872350-147872372 GGTCCTACACAGATGGGACACGG + Intronic
1003079574 6:3010463-3010485 TTTCCCACACAGCTGGTGCTGGG - Intronic
1003356185 6:5373449-5373471 TGTCCTACACATATGGTAGTTGG - Intronic
1004283501 6:14300329-14300351 GTTCCCACACAGATGGGACGCGG + Intergenic
1004321746 6:14636876-14636898 CATCCTCCTCAGCTGGTACTCGG + Intergenic
1004639747 6:17503737-17503759 CTTTCTCCAAATATGGTACTGGG + Intronic
1009903538 6:69839677-69839699 CTGCCTACACCGATGTTACTTGG + Intergenic
1010502614 6:76619496-76619518 CTTCCTATACAATTTGTACTTGG - Intergenic
1012047301 6:94294125-94294147 CTTACTCCAGAGATGATACTGGG + Intergenic
1014059668 6:117056554-117056576 CTTCTTCAACAGATAGTACTGGG - Intergenic
1015317995 6:131838979-131839001 CTTCTTACACAGATTTTTCTAGG + Intronic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1017819475 6:158038946-158038968 CTTCCTGCACACATGGGACCAGG + Intronic
1018521451 6:164655529-164655551 GTTCCTGCACAGATGGGACGCGG + Intergenic
1019898712 7:4002933-4002955 CTTCCTTCCCAGAGGGCACTGGG + Intronic
1021136482 7:16970976-16970998 CTCCCTACTGGGATGGTACTTGG + Intergenic
1021802069 7:24316939-24316961 CTTCCAACTCAGATGGTTCAAGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1030968884 7:116028515-116028537 GTTCCTGCACAGATTTTACTGGG - Intronic
1031777365 7:125919946-125919968 GGTCCCACACAGATGGGACTTGG - Intergenic
1033909450 7:146246757-146246779 TGTCCTGCACAGATGGGACTCGG + Intronic
1037184676 8:16048249-16048271 CTTCCTGCATACATGATACTAGG + Intergenic
1038157859 8:25007764-25007786 CTTCCAACACAGAGGGAACTTGG - Intergenic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1043182041 8:77097156-77097178 CTTTCTACACTGATGATATTTGG - Intergenic
1046824503 8:118672576-118672598 CTTCATACACTGATGGAAATTGG - Intergenic
1048277669 8:133079229-133079251 CTTCCTACACAGATGGTACTGGG - Intronic
1051692727 9:19733459-19733481 CTTCCTTCACAGATTGTCATTGG - Intronic
1051773754 9:20611221-20611243 CTCCCTCCAAGGATGGTACTGGG - Intronic
1052191852 9:25671259-25671281 GTTCCTGCACAGATGGGACGCGG - Intergenic
1056556744 9:87695645-87695667 CTGCCTACACAGGAGGTGCTTGG - Intronic
1058026188 9:100144071-100144093 GGTCCTACACAGATGGGACACGG + Intronic
1061275518 9:129567881-129567903 CCTCCTACAAAGATGGTATTTGG - Intergenic
1185571658 X:1139295-1139317 ATTCCTACACGGATGATGCTCGG - Intergenic
1190022269 X:46890113-46890135 CTTCCTCCACTGATGGGACGAGG + Intronic
1192792805 X:74399658-74399680 CTTCCCAAACAGATGGCACTAGG + Intergenic
1193279249 X:79627686-79627708 CTTCTTACATAGATGGTGGTAGG - Intergenic
1195622770 X:106973893-106973915 TGTCCTACACAGATCTTACTGGG - Intronic
1196782163 X:119393285-119393307 CTTCTTACACAGATGGCAGCAGG + Intergenic
1198965942 X:142228884-142228906 GTTCCTGCACAGATGGGACATGG - Intergenic
1202024196 Y:20502808-20502830 CTGCCTACACAGTTGCTACCAGG + Intergenic