ID: 1048278677

View in Genome Browser
Species Human (GRCh38)
Location 8:133088423-133088445
Sequence TAGCAGGGCTAGAATTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048278677_1048278680 -1 Left 1048278677 8:133088423-133088445 CCTTTATAATTCTAGCCCTGCTA 0: 1
1: 0
2: 1
3: 8
4: 137
Right 1048278680 8:133088445-133088467 ACTGATCAGTTCTATGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048278677 Original CRISPR TAGCAGGGCTAGAATTATAA AGG (reversed) Intronic
901723000 1:11215412-11215434 TAGCAGGACTAAAATCAAAATGG - Intronic
904657643 1:32061207-32061229 TAGCAGGAACAGAAGTATAATGG + Intergenic
905419667 1:37832206-37832228 TACCAGTGCTAGAAAAATAAGGG - Intronic
909391694 1:75127785-75127807 TAGGAGCGCTAGAATTAAGAAGG + Intergenic
912538517 1:110395012-110395034 TAGCAGGGCTTGAATTATGCAGG + Intergenic
912789481 1:112638064-112638086 TAAAAGGGCTAGAATTGTGAAGG + Intronic
913314768 1:117540534-117540556 TAGAAGGGCTTGACCTATAAGGG - Intergenic
917026481 1:170648376-170648398 TAGCTGGGAGAGAATTATCATGG + Intergenic
917394804 1:174581917-174581939 TAGCAGGGCTAGATAGAGAATGG + Intronic
918491980 1:185090691-185090713 TAGTATGGCGAGAATTGTAAAGG - Intronic
1063351053 10:5355397-5355419 TAGCAGGGAAAGAATGGTAAAGG - Intergenic
1063407051 10:5806192-5806214 TAGAATGGCTAAAATTAAAAAGG - Intronic
1065196551 10:23271595-23271617 TAGCATGGCTAAAATTTAAAAGG - Intronic
1065575127 10:27109884-27109906 TAGAATGGCCATAATTATAAAGG + Intergenic
1068229017 10:54145937-54145959 TACCTGGGCAAGAATGATAATGG - Intronic
1069195263 10:65543705-65543727 AATTAGGGCTAGAATTCTAACGG - Intergenic
1069400940 10:68045562-68045584 TAGTAGGGCCAGTATTTTAAGGG - Intronic
1073342987 10:102760028-102760050 TAGCATGGCTGTAATTAAAAAGG - Intronic
1074039683 10:109776031-109776053 AAGCAGCGCTAGAAGTAAAATGG - Intergenic
1074559459 10:114522104-114522126 TAGCAGGGCTGGAATGAAAGAGG + Intronic
1074966152 10:118492430-118492452 TTGCAAGGCTAGAAATGTAAGGG + Intergenic
1075225067 10:120621341-120621363 GAGAAAGGCTATAATTATAAAGG - Intergenic
1076211665 10:128651742-128651764 TAGAATGGCTAAAATTAAAAAGG + Intergenic
1078931670 11:15917091-15917113 TAGGATGGCTAAAATTAAAAAGG - Intergenic
1082699273 11:56407967-56407989 TAGCATGGATAGAATTGAAAGGG + Intergenic
1082818724 11:57528974-57528996 TAGCAGGGCTGGAATGGTCAAGG - Intronic
1085357518 11:75852640-75852662 TAGCTGGGCTAGAACTAGTACGG - Intronic
1086116364 11:83255232-83255254 AAGCAGGGCTAGAAACACAATGG - Intronic
1086166284 11:83782687-83782709 TAGCAGGGGTACAATGAGAAAGG + Intronic
1086995310 11:93349606-93349628 AAGAAGAGCTAGAATTAGAAGGG + Intronic
1087831203 11:102821435-102821457 AACCAGGGCTGGAATTATGAAGG + Intergenic
1088022631 11:105138165-105138187 TAGGAGGCCTAGAAATACAAAGG + Intronic
1091067278 11:132527404-132527426 TAGGAAGACTAAAATTATAAAGG - Intronic
1091728687 12:2864046-2864068 TAGATGGGCTAGGATTATTAAGG - Intronic
1095711900 12:45298508-45298530 TAGTGGGGGTAGAATTATATTGG + Intronic
1098692665 12:73507824-73507846 TAGCAGGCCTTGAAATAGAAAGG + Intergenic
1101974556 12:109345423-109345445 TAGCTTGGCTAGAATAAAAAAGG + Intergenic
1104084865 12:125465120-125465142 TAGCAGAGCTAGGATTTTGAGGG - Intronic
1107892216 13:44924184-44924206 TAGTAGGGGTAGATTTATTAAGG - Intergenic
1108272481 13:48775020-48775042 TCTCAGGACTAGAAATATAATGG + Intergenic
1109298978 13:60570724-60570746 TAGCAGAGCTAGAAGTAGAGAGG + Intronic
1110945901 13:81416235-81416257 TAGGATGGCTAGAATTGAAAAGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1116377472 14:44221586-44221608 TAGAATGGCTATAATTAAAAAGG + Intergenic
1120328256 14:83055649-83055671 TAGCAGGTCTAAAGTTAAAAAGG - Intergenic
1124795856 15:32778621-32778643 TAGGACGGCTAGAATCAGAAAGG + Intronic
1125310247 15:38371389-38371411 TATCTGGGCCAGAATTATAGAGG - Intergenic
1129922687 15:79333476-79333498 TAGCATCTCCAGAATTATAATGG - Intronic
1131346808 15:91657009-91657031 TACCAAGACTTGAATTATAAAGG - Intergenic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1134430014 16:14194748-14194770 AAGCAGAGCCAGAATTAAAAAGG - Intronic
1135487794 16:22881080-22881102 TGGCAGAGCTAGAATTTGAATGG - Intronic
1139160494 16:64501566-64501588 TAGAATGGCTATAATTAAAAAGG - Intergenic
1141300135 16:82807425-82807447 TAGCAGGGTTAGAACAATAGAGG + Intronic
1141614842 16:85204593-85204615 TAGGATGGCTAGAATCAGAAAGG - Intergenic
1141916987 16:87105216-87105238 TAGCAGGGTTTGAATTAGAATGG + Intronic
1150319311 17:64198321-64198343 TACCAGGGCTAAAGTTCTAAAGG + Intronic
1150675488 17:67243626-67243648 GGGCAGGGCTAGATTTAGAAAGG - Intronic
1150996147 17:70319792-70319814 TAACAAGGCTTGAATTATCAAGG - Intergenic
1154034797 18:10790482-10790504 TAGCAGGTCTAAAATTATCAAGG + Intronic
1157865284 18:51177932-51177954 TAGCAGGCCTAGAATTTAACTGG - Intronic
1165568449 19:36753825-36753847 TAGCAGAGCTAGGATTTGAATGG + Intronic
926783166 2:16494339-16494361 TAGCTGGGATAGAATGATCAAGG - Intergenic
926895480 2:17682785-17682807 TAGTAGGGCTTGAATTAAATAGG - Intronic
926896648 2:17697664-17697686 TAGCATGGTTAAAATTAAAAAGG + Intronic
928675114 2:33643286-33643308 AAGCAGGACTAGAAATATATAGG - Intergenic
929324126 2:40585632-40585654 TAGCATGGCTATAATGAAAAAGG - Intronic
931292771 2:60890405-60890427 TAGCTGGGGTAGGATTCTAAAGG + Intronic
933029996 2:77316513-77316535 TACCAGGGCTGAAAATATAATGG + Intronic
935694258 2:105757441-105757463 TAGGAGGGCTGGAAGTATATGGG + Intronic
939754288 2:146090617-146090639 TATCATAGCTAAAATTATAAAGG - Intergenic
942684796 2:178519905-178519927 TCCCAGGGCTATAATTAAAAGGG + Intergenic
1170017070 20:11793238-11793260 CAACAGTGCAAGAATTATAATGG + Intergenic
1173082540 20:39882667-39882689 AACTAGGGCTATAATTATAATGG + Intergenic
1177091331 21:16772576-16772598 TAGCAGGGATAGAAAGGTAATGG - Intergenic
1178979796 21:37254049-37254071 TAGGAGGGCTCCAATTACAAAGG + Intronic
1178999093 21:37438019-37438041 TAGAATGGCTAAAATTAAAAAGG - Intronic
1182894880 22:33850820-33850842 AGGCAGGGATAGAATTAGAATGG - Intronic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
950766862 3:15279455-15279477 TTGCAGGGTTAGAAATATCAAGG + Intronic
951386217 3:22045876-22045898 CATCAGAGGTAGAATTATAATGG + Intronic
951638066 3:24802028-24802050 TAGGATGGCTAAAATTAAAAGGG - Intergenic
951757308 3:26105149-26105171 TATCATGGCTAGAATTCAAAAGG - Intergenic
951985020 3:28609663-28609685 TAGCAGTGCTAGAATAATAATGG + Intergenic
957899218 3:86466708-86466730 TAGCAGGCTTAGAATTTTAGAGG + Intergenic
960677703 3:120212638-120212660 TAGGATGGCTAGAATTAAAAAGG + Intronic
964925185 3:161947610-161947632 TAGCATGTCTAGAATAAAAAAGG + Intergenic
969552680 4:7881425-7881447 TGGCAGGGATAGAATGATCAGGG - Intronic
970849394 4:20583238-20583260 TACCAATGCTAGAAGTATAATGG - Intronic
970900181 4:21149839-21149861 AAGCAGGAATAAAATTATAAAGG + Intronic
972023060 4:34339050-34339072 TAAAAGAGCTAGAATTATAAGGG + Intergenic
972619679 4:40734851-40734873 GAGCAAGGCTAAAATTCTAAAGG - Intergenic
973200835 4:47500420-47500442 TACCAGGACTAGACTGATAATGG + Intronic
973783892 4:54317410-54317432 TAACATAGCTAGAATTACAAAGG + Intergenic
981897708 4:149823730-149823752 TGGAAAGGCTAAAATTATAAGGG - Intergenic
982027016 4:151261063-151261085 TCACAGGGCTATAATTTTAAGGG - Intronic
983869752 4:172811589-172811611 TACCAGGGCAAGCCTTATAATGG - Intronic
984893799 4:184517506-184517528 TAGCCTGGCTAAAATTAAAAAGG - Intergenic
987683743 5:21169971-21169993 CAGCATGGCTAGAATTTAAACGG - Intergenic
991586390 5:68206394-68206416 TAGAATGGCTAAAATTATAAAGG - Intergenic
993942795 5:94081152-94081174 TAGCATGGCTATAATCAAAAAGG + Intronic
995826799 5:116309130-116309152 TAGCAGGGCTGGGAAGATAAAGG - Intronic
997947725 5:138217183-138217205 TAGCAGGGCAAGAAATCTTAGGG - Intergenic
998790866 5:145765297-145765319 TGCCAGAGCTAGAATGATAATGG + Intronic
1002560841 5:180081091-180081113 TAGCAGGGCTAGGCTCAGAAAGG + Intergenic
1005389957 6:25322980-25323002 GAGGAGGGCTAGAATTGTGATGG + Intronic
1006204709 6:32330309-32330331 TAGCAGAGAGAGAATAATAAGGG - Intronic
1008500354 6:52174934-52174956 AAGCAGAGCTGGAGTTATAAAGG + Intergenic
1008697899 6:54062889-54062911 GTGCAGGGCTAGAATTAATATGG + Intronic
1010453603 6:76030164-76030186 TAGCAGGGATAGAGACATAAGGG + Intronic
1011995208 6:93578042-93578064 AGACAGGGCTAGAATTGTAAAGG + Intergenic
1013217916 6:108046972-108046994 TCCCTGGGCTAGAATTTTAAAGG - Intronic
1016063752 6:139657402-139657424 TAGCTGCTTTAGAATTATAATGG - Intergenic
1018451914 6:163917123-163917145 TAGCAGGGCTAAAATAGAAATGG - Intergenic
1019091119 6:169535089-169535111 TAGCAGAGCTAGCATCATAGAGG - Intronic
1022623664 7:32011644-32011666 TAGAATGGCTAAAATTAAAAAGG + Intronic
1026021487 7:66710556-66710578 TAGAATGGCTAAAATTAAAAGGG - Intronic
1026885951 7:73945497-73945519 TAGAATGGCTAAAATTAAAAGGG - Intergenic
1031219138 7:118941525-118941547 TTTCAGGGCAAGAATTTTAAAGG - Intergenic
1031767370 7:125798416-125798438 TAGAATGGCTAAAATTATAAAGG - Intergenic
1032191436 7:129768070-129768092 TGGCAGGAATAGAATTATTATGG - Intergenic
1033145209 7:138865272-138865294 TACCAAGGCCTGAATTATAATGG + Intronic
1034777703 7:153846160-153846182 TAGAATGGCTAAAATTAAAATGG - Intergenic
1037127050 8:15364359-15364381 TAGGATGGCTACAATTAAAAAGG + Intergenic
1041130635 8:54696120-54696142 TAACTGGAATAGAATTATAAAGG + Intergenic
1041218917 8:55629817-55629839 AAGGATGACTAGAATTATAATGG - Intergenic
1042898984 8:73702858-73702880 TAGAATGGCTAAAATTAGAAAGG + Intronic
1043127406 8:76417065-76417087 AAGCAGTGCAAGAATTATTAAGG - Intergenic
1045738378 8:105321822-105321844 TTGCTGGGCTGGAATTTTAATGG - Intronic
1047026855 8:120833885-120833907 TAGCAGGGCTGGAGTTTTAGGGG + Intergenic
1048278677 8:133088423-133088445 TAGCAGGGCTAGAATTATAAAGG - Intronic
1051784531 9:20727866-20727888 GACCAGGGGTAGAATTAAAAGGG - Intronic
1052147529 9:25068464-25068486 TAGCTGGCCTAAAATTGTAAGGG + Intergenic
1053038067 9:34842893-34842915 TAGAATGGCTAAAATTAAAAAGG - Intergenic
1055943632 9:81673473-81673495 GAGCAGGGGTAGAGTTTTAAAGG + Intronic
1058550484 9:106109660-106109682 TAGCATGGCTAGAATAAAACAGG + Intergenic
1058631462 9:106992312-106992334 TAGCATGGCTAAAATTAAGAAGG + Intronic
1058734315 9:107880062-107880084 AAGAAGGGCTAGAATAATGAGGG + Intergenic
1187196026 X:17084574-17084596 TAGGATGGCTAAAATTAAAAAGG - Intronic
1187779233 X:22799070-22799092 AAGCTGGGCTAGCCTTATAAGGG + Intergenic
1188115934 X:26242572-26242594 TAGAATGGCTAAAATTAAAAAGG - Intergenic
1189223009 X:39388838-39388860 TGGCAGGCCTATAATTATAGTGG + Intergenic
1192375675 X:70558885-70558907 TAGGATGGCTAGAATAAAAAAGG + Intronic
1192745349 X:73932851-73932873 TAGAAGGTCTATAATTAAAAAGG - Intergenic
1197295843 X:124718042-124718064 TAGGATGGCTAGAAGTATAGAGG - Intronic
1197577642 X:128236616-128236638 TAGTAGTGCTAGCATTATGATGG - Intergenic
1199820010 X:151435536-151435558 CAGCAGGGCAAAAATTTTAAAGG - Intergenic