ID: 1048278844

View in Genome Browser
Species Human (GRCh38)
Location 8:133089766-133089788
Sequence TACCCAAGGGAGTTATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048278844_1048278852 21 Left 1048278844 8:133089766-133089788 CCTGTCTATAACTCCCTTGGGTA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1048278852 8:133089810-133089832 CATCCCTGCCCACTCCCCCTCGG No data
1048278844_1048278855 26 Left 1048278844 8:133089766-133089788 CCTGTCTATAACTCCCTTGGGTA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1048278855 8:133089815-133089837 CTGCCCACTCCCCCTCGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048278844 Original CRISPR TACCCAAGGGAGTTATAGAC AGG (reversed) Intronic
909562144 1:77018928-77018950 TTCACAAGGGAGTCAGAGACAGG + Intronic
911629810 1:100170470-100170492 TACCCAGGGGATTTGTAGAGGGG + Intronic
912501435 1:110124999-110125021 TACCTTAGTGACTTATAGACAGG + Intergenic
914771570 1:150690852-150690874 GAGCCAAGGGAGTTAGAGAGAGG - Intronic
915717091 1:157954975-157954997 TACCCTAAGGATTTATAGTCTGG + Intergenic
922053232 1:222015251-222015273 TACCCAAAGGAATTAAAGTCAGG - Intergenic
1065291076 10:24230461-24230483 TACCCAACAGAGTTGTAGAGAGG - Intronic
1067409687 10:46053498-46053520 TAGCCAAGGAAGTTAGAGTCCGG + Intergenic
1068192648 10:53672157-53672179 TATCCAAGGGAGTTGTATGCAGG + Intergenic
1071342631 10:84662843-84662865 TACAGAGGGGAGTTAAAGACAGG + Intergenic
1074233085 10:111557099-111557121 TGCCCAAGGGAGATATTGAAGGG + Intergenic
1078549247 11:12269100-12269122 TCCCCAAGGGAGTCACAGCCAGG - Intergenic
1084376687 11:68782866-68782888 TACCCATGGGAGTCATTCACAGG - Intronic
1090101190 11:123798389-123798411 TAGCCAAAGAAGTTATAGGCAGG - Intergenic
1090330313 11:125926281-125926303 TTCCCAAGGGAGTAACAGAAAGG + Intergenic
1092814573 12:12301667-12301689 AACCAAAGGGACTTATAGATAGG - Intergenic
1102807641 12:115795765-115795787 GTGGCAAGGGAGTTATAGACAGG - Intergenic
1104665952 12:130647406-130647428 CAGCCAAGGGAGTTAGAGTCAGG + Intronic
1105333586 13:19441249-19441271 GACCCTGGGGAGTTCTAGACGGG + Intronic
1109006448 13:56883467-56883489 TAACCAAGGGATTCAGAGACAGG - Intergenic
1113456111 13:110450176-110450198 TACCCATCGGAGTTATTGACGGG + Intronic
1114730499 14:24987780-24987802 TACCCAAGGGAGATGCAGAGTGG + Intronic
1116386235 14:44333966-44333988 TACACAAGGGAGTTAGCTACAGG - Intergenic
1125709468 15:41773360-41773382 GACCCAAGGGAGTACTACACTGG - Intergenic
1129316259 15:74746821-74746843 AACCCAATGGAGATATAGACAGG + Intergenic
1137043265 16:35633524-35633546 TACTCAAAGGAGTTAAAAACAGG - Intergenic
1137742876 16:50798051-50798073 TACCCAAGGGAGATGGAGGCAGG - Exonic
1141171924 16:81696949-81696971 TACCCAAGGCAGCTAAAGCCTGG + Intronic
1148101383 17:45093929-45093951 TGCCCCAGGAAGTTACAGACGGG - Intronic
1148336994 17:46848598-46848620 TCCCCAAGGGGCTTATAGCCTGG - Intronic
1153008426 18:516226-516248 TAGCCAAGGAAGTTAGAGTCAGG + Intergenic
1163521129 19:17792753-17792775 TACCCAAAGGAGTTGAAAACAGG - Intergenic
1166831699 19:45643339-45643361 GACCCAAGGGAGATGCAGACCGG + Intronic
925456886 2:4023593-4023615 TACCCAAAGGAAGTATAGTCAGG - Intergenic
927728407 2:25447384-25447406 TACCCAAAGTAAGTATAGACAGG + Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
938868562 2:135450580-135450602 TAGCCAAGAGAGTAACAGACTGG + Intronic
941890353 2:170574395-170574417 TGCCCAAGGTAATAATAGACAGG + Intronic
944654136 2:201861034-201861056 TAGCCAAGGGAGTTATTCAGTGG + Intronic
946246399 2:218390299-218390321 TACCCAAGGGAAGTACAGAGTGG + Intronic
1171732121 20:28718923-28718945 TTCCCATGGGTGATATAGACTGG - Intergenic
1174441034 20:50553915-50553937 TACCCAAGGGAAGTACAGAGAGG + Intronic
952132770 3:30384192-30384214 GACCCATGGGAGGTACAGACAGG + Intergenic
952856607 3:37776421-37776443 TACTCAAGGGCATTATAGACAGG + Intronic
956657468 3:71566449-71566471 TACACAAGGGTTTTATAGTCAGG - Intronic
958000773 3:87746160-87746182 TAGCCAAGGAAGTTAGAGTCAGG - Intergenic
963100042 3:141592704-141592726 TACCCAGAGGAGTTAGATACTGG + Intronic
969215255 4:5716662-5716684 TAGCCAAGGAAGTTAGAGTCAGG - Intronic
978475762 4:109128122-109128144 TAGCCAAGGAAGTTAGAGTCAGG + Intronic
985428710 4:189857162-189857184 TACCTAATGGGGTTATAGTCTGG + Intergenic
987251332 5:16104202-16104224 TACTCTAGGGAATTATAGAGCGG - Intronic
988763167 5:34338959-34338981 TACCCAAGTGAAATATAGGCAGG - Intergenic
992387062 5:76294866-76294888 TTCCCAAGGTAGTTAGAGGCTGG - Intronic
998507975 5:142687231-142687253 TACCCAGAGGAGGTAGAGACTGG - Intronic
1003544547 6:7048546-7048568 TACCCAAGGGACCTAGAGTCAGG - Intergenic
1004063369 6:12219654-12219676 TACATTTGGGAGTTATAGACTGG - Intergenic
1007851658 6:44808656-44808678 TACTTAAAGGAGTTAAAGACAGG - Intergenic
1010509954 6:76706077-76706099 TACCCAAAAGAATTATAAACAGG - Intergenic
1012502192 6:99900824-99900846 TATCCAAGGGAGTTGTATGCAGG + Intergenic
1012919470 6:105206429-105206451 TTCCCAAGGGAGTTGTGGATTGG - Intergenic
1013459907 6:110365108-110365130 TACCCCAGGGAGTTATTCAAAGG + Intergenic
1014254242 6:119145401-119145423 TACCCAAAGGAGTGATTGAAGGG - Intronic
1017496888 6:154991359-154991381 CAGCCAAGGGAGTCATGGACAGG + Intronic
1023110720 7:36808165-36808187 TAGCCAAGGAAGTTAGAGTCAGG - Intergenic
1025727731 7:64082467-64082489 CATCTAAGGGAGGTATAGACCGG + Intronic
1026346794 7:69481488-69481510 TAGCCAAGGAAGTTAGAGTCTGG + Intergenic
1028078087 7:86539330-86539352 TAGCCAAGGAAGTTAGAGTCAGG - Intergenic
1029998191 7:105030444-105030466 TAATCAAAGGAGTTATAGATTGG + Intronic
1031205587 7:118753231-118753253 TACCCAAGGGACTCATTTACAGG + Intergenic
1033778544 7:144641911-144641933 TTGCTAAGGGAATTATAGACAGG - Intronic
1035487671 7:159239805-159239827 TACCCAAGGGTGGTTTATACTGG + Intergenic
1037058605 8:14478197-14478219 TACCCAATGAAGTTAAAAACAGG + Intronic
1039775459 8:40732009-40732031 TACCTACGGGAGTCAGAGACAGG + Intronic
1040682995 8:49836544-49836566 TAGCCAAGGAAATTATAGTCAGG + Intergenic
1044735346 8:95273003-95273025 TACCAAAGGAATTTATAGCCCGG - Intergenic
1045489944 8:102660531-102660553 GACCCACTGGAGTTACAGACAGG + Intergenic
1047150426 8:122255131-122255153 GCCTCAAAGGAGTTATAGACAGG - Intergenic
1047620984 8:126607671-126607693 TACCCAAGGAAGATTTAGAGTGG + Intergenic
1047648805 8:126898018-126898040 TACCCAAAGGAATTAAAGACAGG - Intergenic
1048278844 8:133089766-133089788 TACCCAAGGGAGTTATAGACAGG - Intronic
1053179056 9:35952128-35952150 TAGCCAAGGAAGTTAGAGTCAGG - Intergenic
1060061494 9:120464291-120464313 GTCTCAAGGGAGTTGTAGACAGG - Intronic
1186467863 X:9797878-9797900 TAACCAAGGCAGTTAAAGAAAGG - Intronic
1186511458 X:10132924-10132946 TAGCCAAGGAAGTTAGAGTCTGG - Intronic
1190040680 X:47069127-47069149 TTCCCAAGGGAGTAAAAGAGAGG - Intergenic
1197855929 X:130914085-130914107 AACCTAATGGACTTATAGACAGG + Intergenic
1199092453 X:143707490-143707512 TCCCCATTGGAGTGATAGACAGG - Intergenic
1199579647 X:149348353-149348375 TAGCCAAGGAAGTTAGAGTCAGG + Intergenic