ID: 1048279075

View in Genome Browser
Species Human (GRCh38)
Location 8:133091385-133091407
Sequence GTGTCAGAGGGTCCTCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048279075_1048279080 -9 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC No data
Right 1048279080 8:133091399-133091421 CTCTGACACATGGATGCCCCAGG No data
1048279075_1048279086 22 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279075_1048279081 -8 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC No data
Right 1048279081 8:133091400-133091422 TCTGACACATGGATGCCCCAGGG No data
1048279075_1048279085 21 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC No data
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048279075 Original CRISPR GTGTCAGAGGGTCCTCTGGA TGG (reversed) Intronic