ID: 1048279075

View in Genome Browser
Species Human (GRCh38)
Location 8:133091385-133091407
Sequence GTGTCAGAGGGTCCTCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048279075_1048279081 -8 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC 0: 1
1: 0
2: 4
3: 17
4: 225
Right 1048279081 8:133091400-133091422 TCTGACACATGGATGCCCCAGGG No data
1048279075_1048279086 22 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC 0: 1
1: 0
2: 4
3: 17
4: 225
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279075_1048279080 -9 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC 0: 1
1: 0
2: 4
3: 17
4: 225
Right 1048279080 8:133091399-133091421 CTCTGACACATGGATGCCCCAGG No data
1048279075_1048279085 21 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC 0: 1
1: 0
2: 4
3: 17
4: 225
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048279075 Original CRISPR GTGTCAGAGGGTCCTCTGGA TGG (reversed) Intronic
901691858 1:10978855-10978877 GTGACAGAGGGGCCGCTGGTGGG + Intronic
902546849 1:17195565-17195587 GGGTTACAGGGTCTTCTGGAGGG + Intergenic
904786244 1:32985139-32985161 CTGTCAGAAGGTCCTCTGATGGG - Intergenic
907421962 1:54353654-54353676 GGGTCAGAGGCTGCTCTCGAGGG + Intronic
912438741 1:109681683-109681705 GGGGCAGAGGGTACTCTGGGGGG - Intronic
912439547 1:109687910-109687932 GTGAGCGAGGGTCCGCTGGACGG + Intronic
912441264 1:109700128-109700150 GGGGCAGAGGGTACTCTGGGGGG - Intronic
912717935 1:111995065-111995087 CTGGCAGAAGGTCCACTGGAAGG - Intergenic
914994873 1:152534801-152534823 GTGTAAGAGAGTCCTCCGTAAGG + Intronic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
916473352 1:165144991-165145013 GTGTGAGAGTGCCCTCTGGTGGG - Intergenic
916932083 1:169588985-169589007 CTTCCAGAGAGTCCTCTGGATGG - Exonic
916979193 1:170115439-170115461 GTGCCAGAGGGGGCTCTGGAAGG + Intergenic
916988310 1:170215143-170215165 GTGTGAGTGGGTGGTCTGGATGG + Intergenic
917734857 1:177911133-177911155 GTGGCAGAGGGTCTGCAGGATGG + Intergenic
921167189 1:212515434-212515456 GTGTCAGAGACTGCTCTGCAGGG - Intergenic
922052993 1:222012072-222012094 GTCACAGAGATTCCTCTGGAAGG - Intergenic
923064807 1:230507944-230507966 GTGGCAGTGGGGGCTCTGGATGG + Intergenic
923688310 1:236169605-236169627 GTGCCAGAGTGTAATCTGGAAGG + Intronic
1067054996 10:43045136-43045158 CTTTCTGAGGGTCCTCAGGAGGG - Intergenic
1067408541 10:46045052-46045074 GTGGGAGAGGGTCCTCAGGAGGG - Intronic
1067460949 10:46458144-46458166 GTGGCAGAGGGTCCACTTGCTGG + Intergenic
1067626244 10:47926456-47926478 GTGGCAGAGGGTCCACTTGCTGG - Intergenic
1068679842 10:59807829-59807851 GTGTCACAGGCTCCCCTAGATGG - Intronic
1068705826 10:60074301-60074323 GTGACACAGGCTCCTCTGGTTGG + Exonic
1068906658 10:62333717-62333739 ACCTCAGAAGGTCCTCTGGATGG - Intergenic
1070798380 10:79230415-79230437 TTGGCTGAGGGTCCTCAGGAGGG - Intronic
1072583993 10:96765369-96765391 TTGACAGAGGGTCATCTTGAAGG - Intergenic
1072850431 10:98884814-98884836 CTGTCAGAGGGATCTCTGCAAGG - Intronic
1073459610 10:103659128-103659150 GTGTCCCAGGGTCCTGTAGATGG + Intronic
1076527455 10:131121041-131121063 GTGCCAGAGGGGCTTCTGGTTGG + Intronic
1076831193 10:132995120-132995142 ATGCCAGGGTGTCCTCTGGATGG + Intergenic
1076894454 10:133303135-133303157 CTCTCAGAGGGTCCTCTGCATGG + Intronic
1076894474 10:133303195-133303217 CTCTCAGAGGGTCCTCTGGACGG + Intronic
1076894490 10:133303254-133303276 CTCTCAGAGGGTCCTCTGCATGG + Intronic
1076894512 10:133303314-133303336 CTCTCAGAGGGTCCTCTGGGTGG + Intronic
1079478945 11:20860790-20860812 GTGTCAGCGGGAGCTCTGGCAGG + Intronic
1081598570 11:44476215-44476237 GTGTCAGGGAGTCCTCTGGGAGG + Intergenic
1082768172 11:57184820-57184842 CTGTCAGGGGCTCCTCTGGCTGG + Intronic
1083604634 11:63970829-63970851 GTGTCTGAGCTTCCTCTGGAGGG - Intergenic
1083743407 11:64722770-64722792 GGGTCGGAGGCTCCTGTGGAAGG - Intronic
1083756309 11:64793510-64793532 GGCTGAGAGGGTCCCCTGGAGGG - Intronic
1084740785 11:71138230-71138252 TTGTGAGAGGGGGCTCTGGACGG - Intronic
1085818025 11:79762058-79762080 GTGTCAAAGGGCCCATTGGATGG - Intergenic
1089117905 11:116111198-116111220 GTCTCAGATTGACCTCTGGAGGG + Intergenic
1090186093 11:124740058-124740080 GTGTCGGGGGGTCCTCTGCGGGG - Exonic
1094834916 12:34317798-34317820 GAGTCAGAGGCACCTGTGGAAGG - Intergenic
1097955422 12:65480569-65480591 GTGTGAGAGAGACCTCAGGATGG - Intronic
1099609455 12:84849086-84849108 GAGACAGAGAGTGCTCTGGAGGG + Intergenic
1102983781 12:117262827-117262849 TTGTCAGCTGGTCCTCTGGCTGG + Intronic
1103023909 12:117558281-117558303 GTGTCAGAGGGACCAGTAGAGGG + Intronic
1103621564 12:122190192-122190214 GTGCCGGAGGGTCCTCAGGCTGG - Exonic
1103725989 12:122997618-122997640 GTGACAGAGGGGCCTCAGCAAGG - Intronic
1103859409 12:124000214-124000236 GTGTGAGATGGTTGTCTGGAGGG - Intronic
1105267012 13:18829541-18829563 GTGTCACAGAGTCCAGTGGAAGG - Intergenic
1106186443 13:27413991-27414013 GTGACCCAGGATCCTCTGGAAGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107029109 13:35832834-35832856 GAGCCAGAGGCTCCTCAGGAAGG + Intronic
1107127221 13:36858633-36858655 GTGTGTAAGGGTGCTCTGGAAGG - Intronic
1107645059 13:42485587-42485609 GTGTCTGTGGGTCATCTGGGTGG - Intergenic
1111029681 13:82579022-82579044 ATGTGAGAGGGGCCTCTTGAAGG + Intergenic
1112436094 13:99392309-99392331 GTGTCAGAGGCTCCCCCAGACGG - Intergenic
1116860348 14:49990530-49990552 TGGTCAGAGGATCCTCAGGAGGG + Intronic
1119423504 14:74522007-74522029 GTGTCTGAGGGACCCCTGCAAGG - Exonic
1121060428 14:90903191-90903213 ATCTCAGAGTGTCCTCTGGGGGG + Intronic
1121236498 14:92395062-92395084 GGGTCGGAGTGGCCTCTGGACGG + Intronic
1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG + Intronic
1126099705 15:45111807-45111829 GTCCCAGCGGCTCCTCTGGAAGG + Exonic
1127905777 15:63374707-63374729 GTGTCAGATCTTTCTCTGGACGG + Intronic
1129727560 15:77909306-77909328 GTGCCAGAGGCCCCTCTGGGCGG - Intergenic
1130258578 15:82337332-82337354 GTGCCAGAGGCCCCTCTGGGTGG - Intergenic
1130596345 15:85252628-85252650 GTGCCAGAGGCCCCTCTGGGTGG + Intergenic
1130787599 15:87117335-87117357 GTATTAGAGGGTCCTCTGGGAGG + Intergenic
1130924788 15:88376939-88376961 CTGTCAGAGGTTCTTCTGGCAGG - Intergenic
1132268037 15:100495112-100495134 CTGTCTGATGGTTCTCTGGAAGG - Intronic
1132539255 16:500750-500772 GAGGCAGAGGGTCCTCAGCATGG - Intronic
1133948572 16:10370356-10370378 GTGTCAGCTGGTCCTCTTGCAGG + Intronic
1138475554 16:57268889-57268911 GTGTGTGAGGCTCCTCAGGAGGG + Intronic
1139407113 16:66727777-66727799 GAGCCAGAGGGTCCTCTTGCAGG + Exonic
1140126757 16:72124467-72124489 GTGTCAGGATGTACTCTGGAAGG + Intronic
1141344065 16:83229130-83229152 GCCTCAGAGGGTTCTCAGGAAGG + Intronic
1142890585 17:2940248-2940270 GGGACAGAGGGGCCTCTGGGTGG + Intronic
1143771656 17:9173023-9173045 GTGTCAGAGAGCCCTAGGGAAGG - Intronic
1146548420 17:33759251-33759273 ATGCCAGAGGGTGCTGTGGAAGG + Intronic
1147381037 17:40056435-40056457 GTGGCCGGGGGTCATCTGGAAGG - Intronic
1147963027 17:44179185-44179207 GTGTGAGAGGAGCCACTGGAGGG - Intergenic
1148677923 17:49455717-49455739 GTTTCACAGGGACTTCTGGAAGG + Intronic
1149439505 17:56662927-56662949 GCTTCAGAGGGTCCTATTGAAGG + Intergenic
1151113210 17:71703696-71703718 ATGTCAGAGGAGGCTCTGGAAGG - Intergenic
1152808553 17:82370719-82370741 GTCTCCGAGCGTCCGCTGGACGG - Intergenic
1153198369 18:2625255-2625277 GTGGAACATGGTCCTCTGGAGGG - Intergenic
1154228021 18:12526194-12526216 GTCTCAGAGGGTACTATGCAGGG - Intronic
1160083749 18:75754581-75754603 GTGACACAGGGGCCACTGGAGGG + Intergenic
1161155437 19:2730191-2730213 GTGTCAGAGGCTCCTCTAGAGGG + Intronic
1161593807 19:5141185-5141207 GTCACAGAGGCTCATCTGGAAGG + Intronic
1161692046 19:5741445-5741467 ATGTTGGGGGGTCCTCTGGAGGG + Intronic
1161727433 19:5938006-5938028 GTGTTTCAGGGTCCTCAGGAAGG - Intronic
1163060702 19:14759360-14759382 GGGTCAGAGAGTCCTCAGTAAGG - Intronic
1164055423 19:21618094-21618116 ATGTCAGGGTGTCCTCTGGAAGG - Intergenic
1164735733 19:30539700-30539722 GTGCCTGGGGGTACTCTGGAAGG + Intronic
1166966037 19:46529730-46529752 GGGTCAGAGCGCCCTCTGGTGGG - Intronic
925224939 2:2175625-2175647 GTTTCAGAGGAGCCTCTGCAAGG + Intronic
925731538 2:6922523-6922545 GTGTGTTAAGGTCCTCTGGAGGG + Intronic
926207118 2:10841676-10841698 TTGTCACAGGGGGCTCTGGAGGG - Intergenic
927421677 2:22939865-22939887 GTTTCAGATGGTCCTTTGAAGGG - Intergenic
927476952 2:23420791-23420813 CTGTCAGCGGGGCCTCTGGGTGG + Intronic
928083225 2:28328055-28328077 TTGTCACAGGGGCCTTTGGAGGG + Intronic
928177478 2:29044648-29044670 TTGTCAGAGGAGCCTCTTGAGGG + Intronic
929532981 2:42763937-42763959 CTGTGGGGGGGTCCTCTGGAGGG - Exonic
930013862 2:46957583-46957605 GGGTCAAGGGGTGCTCTGGAGGG + Intronic
932172009 2:69565885-69565907 GTGGCAGAGTGTCCTCTCCACGG + Intronic
932240545 2:70153058-70153080 GTGGCAGAGTGTGTTCTGGAAGG + Intronic
932819453 2:74887073-74887095 GTGTCACAAGGTCCTGTGCATGG + Intronic
934496743 2:94809195-94809217 GTGTCATAGAGTCCAATGGAAGG - Intergenic
935118667 2:100160690-100160712 CAGTCACAGGGCCCTCTGGAAGG + Intergenic
935710675 2:105895411-105895433 ATGTCAGATGGACCACTGGAGGG + Intergenic
936078619 2:109417530-109417552 CTGGCTGAGGGTCCTGTGGAGGG - Intronic
939651103 2:144762978-144763000 TTGTTACTGGGTCCTCTGGAAGG - Intergenic
939752858 2:146069654-146069676 GTGTATTAGGGTTCTCTGGAGGG - Intergenic
940345684 2:152625341-152625363 GTGTCAAAGTGTCATCTGCAAGG + Intronic
945485981 2:210396147-210396169 GTGTAAGAGAATCATCTGGAGGG + Intergenic
947736975 2:232460204-232460226 GTGTCAGCAGGTGCTCTGGGAGG + Intergenic
947823676 2:233089931-233089953 CTCTCAGAGGGTTCTTTGGAAGG - Intronic
948276923 2:236715916-236715938 GTGTGGGAGGGCCCTCGGGAGGG + Intergenic
948467143 2:238158110-238158132 GTGGCAGAGAGGCCTCTGGGCGG - Intergenic
948571672 2:238921726-238921748 GTATTAGAGGGGCCCCTGGAAGG + Intergenic
948792177 2:240384738-240384760 GGGGCAGAGAGTCCTCTGGGGGG + Intergenic
1169050204 20:2569864-2569886 GTGTCTGGGGCCCCTCTGGAGGG - Intronic
1169355820 20:4904168-4904190 GTGTCAGCTTGACCTCTGGAGGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170727988 20:18947000-18947022 GTCGCACAGGGGCCTCTGGAAGG - Intergenic
1171320169 20:24236066-24236088 GTGTCTGAGGCTAATCTGGAAGG + Intergenic
1171888049 20:30675944-30675966 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1172031225 20:31983578-31983600 GTGGGAGAGGGTCCCCGGGAGGG + Intronic
1173524828 20:43723906-43723928 GGGGCAGAGGGTGCTCTGGCTGG - Intergenic
1173673741 20:44815926-44815948 GTGACAAAGGGTCCTATGGCCGG + Intergenic
1173799556 20:45886611-45886633 GAGCCAGAGGGTGCTGTGGAGGG - Exonic
1174339821 20:49888659-49888681 GGGTCAGAGCGCCCTCTAGAGGG + Exonic
1175248092 20:57593288-57593310 GTGTCAGAGCCTCCTGGGGAGGG + Intergenic
1175973153 20:62697275-62697297 GTGTCAGCTGCACCTCTGGAGGG + Intergenic
1176247514 20:64104508-64104530 GTGTCTGACGGTCCTCTCCATGG - Intergenic
1176247549 20:64104645-64104667 GTGTCTGACGGTCCTCTCCATGG - Intergenic
1176247604 20:64104841-64104863 GTGTCCGACGGTCCTCTCCATGG - Intergenic
1176852077 21:13928049-13928071 GTGTCACAGAGTCCAATGGAAGG - Intergenic
1178981708 21:37269950-37269972 GTATCAGAGGGCCTGCTGGAAGG - Intergenic
1179453075 21:41478658-41478680 GTGCCAGAGGGTGCTCTGTGAGG - Intronic
1180007170 21:45028116-45028138 GGGTCACAGGGTCCTGAGGAGGG + Intergenic
1180007181 21:45028152-45028174 GGGTCACAGGGTCCTGCGGAGGG + Intergenic
1180007235 21:45028364-45028386 GGGTCACAGGGTCCTGAGGAGGG + Intergenic
1180007285 21:45028580-45028602 GGGTCACAGGGTCCTGAGGAGGG + Intergenic
1180007327 21:45028760-45028782 GGGTCACAGGGTCCTGCGGAGGG + Intergenic
1180007338 21:45028796-45028818 GGGTCACAGGGTCCTGTGGAGGG + Intergenic
1181084386 22:20432557-20432579 TTGGCAGAGGGGCTTCTGGAGGG + Intronic
1182005843 22:26958946-26958968 TTGGCAGAGGGTCCTATGCATGG - Intergenic
1182320622 22:29476643-29476665 GTGTCAGAGGGTACCCAGGCCGG + Intergenic
1182478008 22:30587076-30587098 TTGTCAGAGGGGTCTCTGAAGGG - Intronic
1182548748 22:31090147-31090169 GTGTCAGAGGGGCCTCTGGTGGG - Exonic
1183018077 22:35006307-35006329 GGGTCTGAGGGTGCTGTGGAGGG + Intergenic
1185315912 22:50179034-50179056 GTGTCAGAGGGGCCACAGCAGGG - Exonic
949564029 3:5228746-5228768 ATGGCAGAGGGTCCTTAGGAAGG - Intergenic
950131824 3:10552465-10552487 GTGTGAGAGGGAGCTATGGAGGG - Intronic
950646758 3:14381970-14381992 GTGTGAGAGGTTCCGCTGGGCGG + Intergenic
950709269 3:14803413-14803435 GTGTCAGAGGTGCCTCTGTGAGG + Intergenic
952252209 3:31665825-31665847 GGGTCAGGGGGTCCTCTGAAGGG + Intronic
952428627 3:33200827-33200849 GTGTCCTAGGGTCTTATGGAAGG + Intronic
952924404 3:38310597-38310619 GTCTCTCAGGGTCCTCTGTAGGG + Intronic
954520286 3:51219078-51219100 GAGTCAGAGGGTCCTCTAAAAGG - Intronic
954641065 3:52098207-52098229 CTGCTAGGGGGTCCTCTGGAAGG - Intronic
955940167 3:64139762-64139784 TTGTCAGAAGGTCCTATGGCTGG - Intronic
961578442 3:127857738-127857760 GAGACTTAGGGTCCTCTGGAAGG - Intergenic
961714740 3:128850494-128850516 GTGGCAGAGGGGTCTCTGCATGG - Intergenic
962922586 3:139964495-139964517 GTTTCAAAGTGTCATCTGGAAGG + Intronic
967413876 3:189195604-189195626 GTGTCAGCATCTCCTCTGGAGGG + Intronic
968351231 3:198054994-198055016 GTGTCATAGAGTCCAATGGAAGG - Intergenic
968351373 3:198056497-198056519 ATGTCAGAGTCTCCACTGGAAGG - Intergenic
968870721 4:3240777-3240799 ATGTCAGCGGGTGCTCAGGAGGG - Exonic
969471914 4:7394136-7394158 GTGGAAGGGGGTCCTCTTGATGG + Intronic
969661738 4:8534079-8534101 GAGTCAAAGTGTCCTCTGGGAGG + Intergenic
970595680 4:17597842-17597864 GTGGCAGCAGGTCCTCTGGGTGG + Intronic
971758323 4:30731775-30731797 AGGTCAGGGAGTCCTCTGGATGG + Exonic
977570364 4:98622533-98622555 ATGTCTGAGGGTTCTCTGGAGGG + Intronic
979070135 4:116192565-116192587 GTGTCCTAGGCTCCTCTTGATGG - Intergenic
980981147 4:139655523-139655545 GTGTCAGAGGGTGGACTGGAAGG - Intergenic
983593671 4:169441944-169441966 GGGTCTCAGGGCCCTCTGGAAGG - Intronic
986089491 5:4489788-4489810 GTGTCAGTTGGTTCTCTGCAAGG + Intergenic
986387119 5:7245529-7245551 GTGTCAGTGGGTGGTTTGGAAGG + Intergenic
987422036 5:17731652-17731674 GTGTCAGGGGGAACTCTGGCGGG + Intergenic
987503487 5:18743063-18743085 GTGCCAGAGGGATCACTGGAAGG - Intergenic
988787301 5:34576936-34576958 GTGGCACAGGGGCCTCTGGCAGG - Intergenic
992319749 5:75601894-75601916 GTGTATTAGGGTCCTCTAGAGGG - Intergenic
992608383 5:78485441-78485463 GGGTCAGTAGGTGCTCTGGAGGG - Exonic
997467203 5:134096209-134096231 GTGTCAGTGGGGCCTGGGGAGGG - Intergenic
999697274 5:154198278-154198300 GTGGCAGAGAGTTCTCTTGAGGG + Intronic
1001381939 5:171311171-171311193 GTGCCAGAGGGTCTCCAGGAGGG - Intronic
1001595612 5:172896861-172896883 GAGTCAGAAGGGGCTCTGGAGGG + Intronic
1002162223 5:177321226-177321248 GTGTCAGGGTGTCCTCTTCAAGG + Intergenic
1004323003 6:14647702-14647724 GAGGCAGAGGGTCCTCAGGCTGG + Intergenic
1006924648 6:37647794-37647816 ATGTCACAGGGGCCTCTGGCTGG + Intronic
1006987393 6:38184984-38185006 GTGTCAGAGGAGCATCTGCATGG - Intronic
1009546696 6:65029889-65029911 GTGCCAGTGGGTCCTGGGGAAGG + Intronic
1010956680 6:82098293-82098315 GAGTCAGAGGGTACTCTGTAGGG - Intergenic
1011260605 6:85466135-85466157 TTGTCAGTGGGGCCTCTGCATGG + Intronic
1012227706 6:96723955-96723977 GTGTAATAGGGTTCTCTAGAGGG + Intergenic
1014041530 6:116832486-116832508 GTCAGAGAGTGTCCTCTGGAAGG + Intergenic
1016833734 6:148456412-148456434 CTGGCAGGGGCTCCTCTGGAAGG - Intronic
1017751654 6:157494327-157494349 GTGTCAGAGGGTGCAGGGGAAGG - Intronic
1018167954 6:161117034-161117056 GTGGCAAAAGGCCCTCTGGAGGG + Exonic
1018475648 6:164138210-164138232 GTGTCAGAAACTCCCCTGGAAGG - Intergenic
1023857092 7:44190591-44190613 GTGTCAGTGTTTCTTCTGGATGG + Intronic
1023887186 7:44367641-44367663 GTGTCAGCGTCTCCTCTGGAGGG - Intergenic
1023996847 7:45163794-45163816 GTGCCAGTGGGGCATCTGGAGGG + Intronic
1026527603 7:71168946-71168968 GTGTCTGTGTGTCCTCTGGCTGG + Intronic
1026825605 7:73579380-73579402 GTGTCTGAGGATTCCCTGGATGG + Intergenic
1031398482 7:121302498-121302520 GTGGCAGAGGTTCCGCTGGGTGG + Intergenic
1032080379 7:128855684-128855706 GTGTGAGAGGCTCCTCTAAAGGG + Intronic
1032490270 7:132319082-132319104 GTTTCAGAAGGGCCTTTGGATGG - Intronic
1033048474 7:137983234-137983256 GTGGTAGATAGTCCTCTGGAAGG - Intronic
1034277723 7:149830937-149830959 GTGACAGAGGGGACTGTGGAGGG - Intergenic
1034411898 7:150946362-150946384 CTGTCACAGGGTCATCTTGAGGG - Intronic
1034845998 7:154445552-154445574 GTGCAAGAGGGTTCTCTGGAAGG + Intronic
1039468223 8:37798158-37798180 GTGGGAGAGGGGCCTCTAGAGGG - Intronic
1040469463 8:47725174-47725196 CTTTCAAAGGGTCCTCAGGATGG - Intronic
1042780753 8:72488707-72488729 TTGTCAGAGGTTACTATGGAGGG + Intergenic
1043388633 8:79770141-79770163 AGGTCAGAGGGACTTCTGGAAGG - Intergenic
1048279075 8:133091385-133091407 GTGTCAGAGGGTCCTCTGGATGG - Intronic
1049211691 8:141389583-141389605 GTGTCAGGGATTCCTCTGCAGGG + Intergenic
1052874870 9:33550484-33550506 ATGTCAGAGTCTCCACTGGAAGG + Exonic
1052875258 9:33555077-33555099 GTGTCATAGAGTCCAATGGAAGG + Intronic
1052875301 9:33556101-33556123 GTGTCATAGAGTCCAATGGAAGG + Intronic
1053500713 9:38588248-38588270 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1053500760 9:38589272-38589294 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1053660407 9:40271253-40271275 GTGTCATAGAGTCCAATGGAAGG + Intronic
1053910777 9:42900604-42900626 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1054361409 9:64124169-64124191 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1054372525 9:64417483-64417505 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1054524205 9:66105035-66105057 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1054680153 9:67907247-67907269 GTGTCATAGAGTCCAATGGAAGG + Intergenic
1056088383 9:83179420-83179442 GTGTAAAAGGGTACTCAGGAAGG - Intergenic
1056753260 9:89366868-89366890 GAGTCACAGGAGCCTCTGGAAGG + Intronic
1057680112 9:97172650-97172672 GTGTCATAGAGTCCGATGGAAGG - Intergenic
1057680156 9:97173674-97173696 GTGTCATAGAGTCCAATGGAAGG - Intergenic
1057680547 9:97178337-97178359 ATGTCAGAGTCTCCACTGGAAGG - Intergenic
1058078050 9:100670414-100670436 GGGTAAGAGAGTCCTCAGGAAGG - Intergenic
1058631558 9:106993560-106993582 ATCTCAGTGGGTCCTCTAGAAGG + Intronic
1188105847 X:26145802-26145824 CTGTCAGAGGTTCCACTGAAAGG - Intergenic
1190912081 X:54782075-54782097 CTGTCAGAGCACCCTCTGGAGGG + Intronic
1196524928 X:116720512-116720534 GTGTCACAGGGTGCTCAGTAGGG + Intergenic