ID: 1048279080 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:133091399-133091421 |
Sequence | CTCTGACACATGGATGCCCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1048279073_1048279080 | 9 | Left | 1048279073 | 8:133091367-133091389 | CCAGGAGGGAGGCGGAGTCCATC | No data | ||
Right | 1048279080 | 8:133091399-133091421 | CTCTGACACATGGATGCCCCAGG | No data | ||||
1048279075_1048279080 | -9 | Left | 1048279075 | 8:133091385-133091407 | CCATCCAGAGGACCCTCTGACAC | No data | ||
Right | 1048279080 | 8:133091399-133091421 | CTCTGACACATGGATGCCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1048279080 | Original CRISPR | CTCTGACACATGGATGCCCC AGG | Intronic | ||