ID: 1048279080

View in Genome Browser
Species Human (GRCh38)
Location 8:133091399-133091421
Sequence CTCTGACACATGGATGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048279073_1048279080 9 Left 1048279073 8:133091367-133091389 CCAGGAGGGAGGCGGAGTCCATC No data
Right 1048279080 8:133091399-133091421 CTCTGACACATGGATGCCCCAGG No data
1048279075_1048279080 -9 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC No data
Right 1048279080 8:133091399-133091421 CTCTGACACATGGATGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048279080 Original CRISPR CTCTGACACATGGATGCCCC AGG Intronic