ID: 1048279085

View in Genome Browser
Species Human (GRCh38)
Location 8:133091429-133091451
Sequence TGCCAGACCTCCTGCTTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048279076_1048279085 17 Left 1048279076 8:133091389-133091411 CCAGAGGACCCTCTGACACATGG No data
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data
1048279083_1048279085 -10 Left 1048279083 8:133091416-133091438 CCCAGGGCAGAGCTGCCAGACCT No data
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data
1048279082_1048279085 -9 Left 1048279082 8:133091415-133091437 CCCCAGGGCAGAGCTGCCAGACC No data
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data
1048279079_1048279085 8 Left 1048279079 8:133091398-133091420 CCTCTGACACATGGATGCCCCAG No data
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data
1048279078_1048279085 9 Left 1048279078 8:133091397-133091419 CCCTCTGACACATGGATGCCCCA No data
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data
1048279075_1048279085 21 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC No data
Right 1048279085 8:133091429-133091451 TGCCAGACCTCCTGCTTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048279085 Original CRISPR TGCCAGACCTCCTGCTTGTC CGG Intronic