ID: 1048279086

View in Genome Browser
Species Human (GRCh38)
Location 8:133091430-133091452
Sequence GCCAGACCTCCTGCTTGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048279082_1048279086 -8 Left 1048279082 8:133091415-133091437 CCCCAGGGCAGAGCTGCCAGACC No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279083_1048279086 -9 Left 1048279083 8:133091416-133091438 CCCAGGGCAGAGCTGCCAGACCT No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279079_1048279086 9 Left 1048279079 8:133091398-133091420 CCTCTGACACATGGATGCCCCAG No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279075_1048279086 22 Left 1048279075 8:133091385-133091407 CCATCCAGAGGACCCTCTGACAC No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279076_1048279086 18 Left 1048279076 8:133091389-133091411 CCAGAGGACCCTCTGACACATGG No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279078_1048279086 10 Left 1048279078 8:133091397-133091419 CCCTCTGACACATGGATGCCCCA No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data
1048279084_1048279086 -10 Left 1048279084 8:133091417-133091439 CCAGGGCAGAGCTGCCAGACCTC No data
Right 1048279086 8:133091430-133091452 GCCAGACCTCCTGCTTGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048279086 Original CRISPR GCCAGACCTCCTGCTTGTCC GGG Intronic