ID: 1048280217

View in Genome Browser
Species Human (GRCh38)
Location 8:133100231-133100253
Sequence TCTGATAAGCAGACCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048280217_1048280221 8 Left 1048280217 8:133100231-133100253 CCCTTCAGGGTCTGCTTATCAGA 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1048280221 8:133100262-133100284 GCTTGACCACTTGGATTCAGAGG No data
1048280217_1048280222 9 Left 1048280217 8:133100231-133100253 CCCTTCAGGGTCTGCTTATCAGA 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1048280222 8:133100263-133100285 CTTGACCACTTGGATTCAGAGGG No data
1048280217_1048280219 -1 Left 1048280217 8:133100231-133100253 CCCTTCAGGGTCTGCTTATCAGA 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1048280219 8:133100253-133100275 AAAGACCTTGCTTGACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048280217 Original CRISPR TCTGATAAGCAGACCCTGAA GGG (reversed) Intronic
907841730 1:58164831-58164853 TATGTTAAGCAGATGCTGAAAGG - Intronic
913243625 1:116852250-116852272 CCTGAAAAGCAGACTCTGAAAGG + Intergenic
916841719 1:168608265-168608287 CTTGATAAGCAGAACCTGATTGG - Intergenic
917498932 1:175568175-175568197 CCTGAAAAGCAGTCCTTGAATGG - Intronic
917637998 1:176955738-176955760 TCTGACAGGCAGACCCTGAGGGG + Intronic
918763816 1:188451811-188451833 TTTGATAAGCAAATCCTTAAAGG - Intergenic
920031503 1:203040153-203040175 CCTGATAACCAGACCCAGAGAGG + Intronic
1067211176 10:44261317-44261339 TCTGATACGCAGCGCCTGATGGG - Intergenic
1067973521 10:50997609-50997631 TCTGATAAGCAGATTCTCAATGG - Intronic
1068039667 10:51807944-51807966 TCAGAAAAACACACCCTGAAGGG - Intronic
1071246028 10:83764744-83764766 TCTAATACAAAGACCCTGAAGGG + Intergenic
1071338609 10:84622342-84622364 TGTGCTAAGGAGACACTGAAAGG + Intergenic
1074847443 10:117410717-117410739 TCAGATAAGCAGATCTTGATGGG - Intergenic
1078562259 11:12383251-12383273 TCTGGCAAGTAGACTCTGAAAGG - Intronic
1080883300 11:36342587-36342609 TCTGATAAAACCACCCTGAATGG + Intronic
1085707373 11:78798787-78798809 TCTGTGAGCCAGACCCTGAAAGG - Intronic
1088419393 11:109625769-109625791 TCTGAAAAGCAAAACCTGAAAGG + Intergenic
1088644389 11:111905079-111905101 TCTGCTATGGGGACCCTGAAGGG - Intergenic
1089403063 11:118175967-118175989 TCTGAAAAGAAGCCCCTTAAGGG + Intronic
1090661135 11:128882403-128882425 TCTGATAAGCCCATCCTTAATGG - Intergenic
1092778092 12:11961576-11961598 TCTGAAAAACATACACTGAAAGG - Intergenic
1104045459 12:125159713-125159735 GCTGAAAAGCAGGCCCTGAGAGG - Intergenic
1106910496 13:34458101-34458123 TGTGATAGGCAGCCTCTGAAAGG + Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1107116809 13:36755911-36755933 TCTGGTGAGATGACCCTGAATGG + Intergenic
1110656597 13:78007407-78007429 TCTGATTAGCAGCTCCTGGACGG - Intergenic
1111165933 13:84456794-84456816 TCTGATTGGCAGAACCTAAATGG - Intergenic
1112077137 13:95927883-95927905 TTTGTTAAACAGACCCTGCAAGG - Intronic
1114424583 14:22611406-22611428 GCAGTTAAGCAGACCCTGGATGG - Exonic
1117757748 14:58993123-58993145 TCTGAGAAGCAGACCAAGACAGG - Intergenic
1119337666 14:73847841-73847863 TCTGGAAAGCAAACCCTGATGGG - Intergenic
1121988183 14:98528649-98528671 TCTCATAAGCATGCCCTGATGGG + Intergenic
1122763934 14:104051734-104051756 TCTCAAAAGAAGACACTGAAGGG - Intronic
1125265829 15:37879911-37879933 TATGGTAAGCTGAGCCTGAATGG - Intergenic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1132233813 15:100204290-100204312 TCTCAAAGGCAGACCCTGTAAGG - Intronic
1132478273 16:153333-153355 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1132480358 16:163923-163945 TCTGACAAGCAGAGGGTGAAAGG + Intronic
1139015254 16:62682510-62682532 TAGGAAAAGCAGTCCCTGAAAGG + Intergenic
1141433197 16:83981433-83981455 TCTTGTAAGCCCACCCTGAAGGG - Intronic
1142566824 17:845553-845575 TCTAAGATGTAGACCCTGAAGGG - Intronic
1144247185 17:13378596-13378618 TCTCATATCCAGAGCCTGAAGGG - Intergenic
1144403448 17:14929289-14929311 GGTGAGAAGGAGACCCTGAAGGG + Intergenic
1146259234 17:31410875-31410897 TCTGATGATGAGACCCTGAGAGG - Intronic
1146455911 17:33009528-33009550 TTTGAGAACCAAACCCTGAACGG - Intergenic
1149521641 17:57322347-57322369 TCTGATTAGGAGAACTTGAATGG + Intronic
1152676621 17:81644720-81644742 GGTGATGAGCAGACTCTGAAAGG - Intronic
1155303827 18:24459422-24459444 TCTTAAAAGCAAAACCTGAAAGG - Intergenic
1156836373 18:41560207-41560229 TCTGATAAGCATACTGTGAGAGG + Intergenic
1161816741 19:6503830-6503852 TCGCATAATCAGACCCTGGAGGG - Intergenic
1164985753 19:32647304-32647326 TCTGATAGGAATGCCCTGAAAGG + Intronic
1166346858 19:42171826-42171848 TCTGTGAGGGAGACCCTGAATGG + Intronic
1168150008 19:54441009-54441031 TCTTAAAAGCAAAACCTGAAAGG + Intergenic
925999565 2:9319376-9319398 TCTGTGAAGGAGACCCTGAGAGG - Intronic
926134256 2:10325587-10325609 CCTGCTAAGCAGGCCCTGGAGGG + Intronic
936622905 2:114118751-114118773 TCAGATAACCAGTACCTGAATGG + Intergenic
936744459 2:115558090-115558112 TCTGAGAAGCAGACCCAAAATGG + Intronic
937732444 2:125249935-125249957 TCTGATAAGCAGATTTTGAGTGG + Intergenic
937802748 2:126099538-126099560 TCTGATAGGAAGAGCCTCAAAGG + Intergenic
938098543 2:128479524-128479546 TCTGATAAGCAGCCAAGGAAGGG + Intergenic
939711738 2:145529727-145529749 TCTGAGTAGCAGACATTGAAAGG + Intergenic
941322812 2:164076439-164076461 TCTGATAAGCAAACCTTTCATGG - Intergenic
941377367 2:164748106-164748128 TTTGATAAGCAGAGCCTGTAGGG + Intronic
941815782 2:169794559-169794581 TAGAATAAGCAGACCCTGAGAGG - Intronic
941908755 2:170742319-170742341 TGTGATAAGAAGAGACTGAAGGG + Intergenic
945299366 2:208201247-208201269 TATAACAAGCAGACCCTGAGAGG + Intergenic
1169343454 20:4812973-4812995 TGGGAAAAGCAGACCCTGCAGGG + Intronic
1172718838 20:36983933-36983955 TCTAACAAGCAGAGCCTGGAGGG - Intergenic
1173137132 20:40448221-40448243 TCTTATAATCAGATCTTGAAAGG - Intergenic
1175326769 20:58135017-58135039 TCTGAAAAGCACACACTGTATGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183651487 22:39156735-39156757 GAGGATGAGCAGACCCTGAAAGG + Intergenic
1184445425 22:44544340-44544362 GCTGAGAAGCAGAGCCTGGAGGG + Intergenic
949404445 3:3699593-3699615 TCAGATATGGAGGCCCTGAATGG + Intergenic
949651013 3:6159490-6159512 GCTGAAAAGCAGATCGTGAAGGG - Intergenic
951809667 3:26685358-26685380 TTTGACAAGCAGAGACTGAAGGG - Intronic
951835701 3:26981081-26981103 TCTGATAAGCAGGCACTGTGGGG - Intergenic
952246583 3:31599606-31599628 TCTAATAATCAGAGCTTGAAAGG - Intronic
954527672 3:51287078-51287100 TCTGATAACCAGAATCTGTAAGG + Intronic
967755322 3:193162067-193162089 GCTTATAAGAAGACCCTGAATGG + Intergenic
969837859 4:9858012-9858034 TCTGATTTGCTGACTCTGAAGGG - Intronic
970183648 4:13426354-13426376 TCTGAGGAGGAGACCATGAAGGG + Intronic
971001491 4:22327729-22327751 TCTGATAAACACACCCTCCAGGG - Intergenic
972256141 4:37357848-37357870 ACTGATAAGGTGACTCTGAAGGG + Intronic
972399678 4:38689017-38689039 TCCGATAAGGAGACCATGAGAGG - Exonic
974099771 4:57403743-57403765 TGTGATGAGGAGACACTGAAAGG + Intergenic
974625270 4:64418293-64418315 TGTGATAAGAAATCCCTGAAAGG - Intergenic
981886404 4:149678226-149678248 TATGATAATCAGACCCTCAAAGG + Intergenic
981978032 4:150755307-150755329 TGTAATAAGCAGACACTGACTGG + Intronic
985715965 5:1461702-1461724 TCTGATAAACAGACTTTGAATGG - Exonic
986221090 5:5769473-5769495 TCTGAGAAGCAGAAGATGAAGGG - Intergenic
989392159 5:40912261-40912283 TGTAATAAGCAGACCTTGATGGG + Intronic
989534324 5:42546475-42546497 TCTGGCAAGCAGGACCTGAATGG - Intronic
992844148 5:80728223-80728245 TCTGTTAAGAATACCCTGTAGGG + Intronic
993457336 5:88141574-88141596 TCTGAGAGGCGGCCCCTGAATGG + Intergenic
995881937 5:116852943-116852965 TCTTAAAAGCAAAACCTGAAAGG + Intergenic
995932709 5:117468746-117468768 GATGATAAACTGACCCTGAATGG + Intergenic
998039779 5:138944804-138944826 ACTGTTAAGCAGACCCTCCAGGG - Intergenic
998151007 5:139757490-139757512 TCTGCCAGGCAGTCCCTGAAGGG + Intergenic
999071873 5:148752027-148752049 TCTTAGAAGCAGACAATGAATGG - Intergenic
1006030248 6:31172417-31172439 CCAGAAAAACAGACCCTGAAGGG - Intronic
1007703157 6:43775953-43775975 TCTGGAAAGCAGACCTTGGAGGG + Intronic
1009331918 6:62433411-62433433 TCTGACAAGCAAATGCTGAAAGG + Intergenic
1011707589 6:90017976-90017998 TCTCAAAAGCAAAACCTGAAAGG - Intronic
1012018882 6:93890523-93890545 TTTGATAAGAAAACCCAGAAAGG - Intergenic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1015429468 6:133113432-133113454 ACTGATTTGCAGACCCTCAATGG + Intergenic
1017719137 6:157232750-157232772 TCACATCAGCAGTCCCTGAAGGG - Intergenic
1018706496 6:166467512-166467534 TCTCATAAGATGACACTGAATGG + Intronic
1020106050 7:5422785-5422807 TCTGGTAACCAGAGCCTGATGGG - Intronic
1020855775 7:13420838-13420860 TCTGGTATGCAGCCACTGAAAGG - Intergenic
1024459288 7:49643519-49643541 TGTGATTAGCAGCTCCTGAAAGG + Intergenic
1027440559 7:78215089-78215111 TCACAAAAGCAGACCCTGAGAGG + Intronic
1029130059 7:98322945-98322967 TCAGATAAGCAGAACTTGCAGGG + Intronic
1034265912 7:149780570-149780592 TCTGAGAGGAAGACCCAGAATGG - Intergenic
1036222493 8:6932254-6932276 TCTTACAAGCAGAACCAGAATGG - Intergenic
1041818900 8:62006414-62006436 CATGAAAATCAGACCCTGAAAGG + Intergenic
1041819901 8:62019430-62019452 TCTGAGAAACTTACCCTGAAGGG + Intergenic
1041974895 8:63786877-63786899 TTTGATAAGCTGATTCTGAATGG - Intergenic
1043525345 8:81090648-81090670 TCTGAGAAGCTGATCCTGATTGG - Intronic
1045697065 8:104821286-104821308 TGTGACAAGCAGACCCTAGATGG - Intronic
1045910705 8:107405550-107405572 CCTTATAAACAGAGCCTGAAGGG - Intronic
1046662157 8:116959618-116959640 TATGAAAAGCAGAAACTGAAAGG - Intronic
1048068567 8:130998475-130998497 TTTCAGAAGCAGACTCTGAAAGG + Intronic
1048280217 8:133100231-133100253 TCTGATAAGCAGACCCTGAAGGG - Intronic
1048437777 8:134433748-134433770 TCTCATTAGCAGCCCCTGCAGGG + Intergenic
1050892989 9:10848994-10849016 TCTGATAAGAATATGCTGAAAGG - Intergenic
1051433079 9:17000387-17000409 TTTGACAAGTAGACCCTGAGAGG - Intergenic
1052333995 9:27301275-27301297 TCTTTAAAGAAGACCCTGAAAGG + Intergenic
1055477933 9:76681823-76681845 GCTGATAAGAATTCCCTGAAAGG - Intronic
1057941534 9:99289361-99289383 TCTGAAATCCAGACCATGAAGGG - Intergenic
1185964685 X:4587185-4587207 TCTGATAAGCAGAACAGGAGAGG + Intergenic
1186700823 X:12087975-12087997 GATGATTAGCAGCCCCTGAAGGG + Intergenic
1187079476 X:15971782-15971804 TCTGATCATCAGAGCTTGAAAGG - Intergenic
1189523219 X:41792082-41792104 TCTGATAGGCAGACCCTGGTGGG - Intronic
1193222786 X:78946421-78946443 TCAGCTAAGGAGTCCCTGAAGGG + Intronic
1195661654 X:107384864-107384886 TCTGACCAGCAGAGCCAGAAGGG + Intergenic
1196971861 X:121118267-121118289 TCTGATAAGGAACTCCTGAAAGG + Intergenic
1200337519 X:155365899-155365921 TCTGAAACCCAGAGCCTGAAGGG + Intergenic
1200348951 X:155475328-155475350 TCTGAAACCCAGAGCCTGAAGGG - Intergenic
1201889086 Y:18921778-18921800 TCTGATAAGCAGACCAGGAGAGG + Intergenic